Question 1: In recombinant DNA technology, restriction endonucleases are primarily used to:

• Cut DNA at specific palindromic recognition sequences (Correct answer)
• Join two DNA fragments with compatible ends
• Amplify a specific DNA sequence exponentially
• Synthesize new DNA strands from an RNA template

Correct answer: Cut DNA at specific palindromic recognition sequences

Restriction endonucleases recognize specific short DNA sequences (typically 4–8 bp palindromes) and cleave the DNA at or near those sites, generating defined fragments for cloning or analysis.

Question 2: Which of the following best describes the 'fundamental attribution error'?

• Overestimating dispositional factors and underestimating situational factors when explaining others' behavior (Correct answer)
• Attributing others' failures to situational factors while attributing one's own failures to dispositional factors
• Attributing positive outcomes to one's own effort and negative outcomes to external causes
• Believing that one's own views are more widely shared than they actually are

Correct answer: Overestimating dispositional factors and underestimating situational factors when explaining others' behavior

The fundamental attribution error is the tendency to overweight internal (dispositional) factors and underweight situational factors when judging others' behavior.

Question 3: A young woman visits the clinic because she believes her "heart is racing." Her pulse is within normal limits when measured. During the conversation, you learn that she is frequently concerned about a variety of issues. In fact, she can't recall a time when she didn't have some event replaying in her mind. She acknowledges that she seeks out relationships to boost her self-esteem and that she stays in them for far too long because she is afraid of being alone. What personality type does this person belong to?

• Cluster C (Correct answer)
• Cluster A
• Cluster B
• This does not seem like a personality disorder.

Correct answer: Cluster C

The young woman's symptoms—frequent worry, chronic anxiety, seeking relationships for self-esteem, and fear of being alone—are characteristic of Cluster C personality disorders. This cluster includes anxious and fearful disorders like Dependent Personality Disorder, which is marked by an excessive need to be cared for, leading to submissive and clinging behavior and fears of separation.

Question 4: What part of the brain is in charge of speech?

• hypothalamus
• occipital lobe
• Broca’s Area (Correct answer)
• cerebellum

Correct answer: Broca’s Area

Broca's Area, located in the frontal lobe of the dominant cerebral hemisphere (typically the left), is a critical brain region primarily responsible for the production of speech. Damage to this area can lead to Broca's aphasia, characterized by difficulty forming words and speaking fluently, while comprehension remains relatively intact.

Question 5: A patient lacks C3 complement protein. Which immune function is most directly impaired?

• Antibody class switching
• T cell activation
• Opsonization and phagocytosis (Correct answer)
• NK cell killing

Correct answer: Opsonization and phagocytosis

C3b, derived from C3 cleavage, is a major opsonin that coats pathogens and enhances phagocytosis; C3 deficiency severely impairs this innate defense.

Question 6: A CARS passage on evolutionary biology states: 'Altruistic behavior in animals poses a challenge to naive interpretations of natural selection.' The word 'naive' as used here most nearly means:

• Childlike and emotionally sincere
• Empirically unverified
• Oversimplified and failing to account for complexity (Correct answer)
• Morally pure and uncorrupted

Correct answer: Oversimplified and failing to account for complexity

In academic prose, 'naive' applied to a theory means it oversimplifies and fails to capture the phenomenon's full complexity.

Question 7: What is the most important professional competency for MCAT certification in psychology?

• Ability to work alone exclusively
• Deep knowledge combined with practical application skills (Correct answer)
• Speed of task completion
• Memorization of all reference materials

Correct answer: Deep knowledge combined with practical application skills

Professional competency requires both deep knowledge of the subject matter and the ability to apply that knowledge in practical situations.

Question 8: An object moving in uniform circular motion has a centripetal acceleration of 10 m/s² at a radius of 2 m. What is the object's speed?

• 20 m/s
• 5 m/s
• 2.24 m/s
• 4.47 m/s (Correct answer)

Correct answer: 4.47 m/s

Centripetal acceleration a = v²/r, so v = √(ar) = √(10 × 2) = √20 ≈ 4.47 m/s.

Question 9: Which property of sound waves increases when the medium's temperature rises?

• Frequency
• Speed (Correct answer)
• Amplitude
• Wavelength in a constant-frequency wave only

Correct answer: Speed

Sound speed in a gas increases with temperature because molecules move faster, transmitting vibrations more quickly.

Question 10: The 'looking-glass self' theory developed by Charles Cooley suggests that one's self-concept is primarily shaped by:

• How one imagines others perceive and judge them (Correct answer)
• Comparison with role models in the media
• Biological drives and temperament established in infancy
• Formal education and socialization institutions

Correct answer: How one imagines others perceive and judge them

Cooley's looking-glass self proposes that individuals develop their identity based on how they think others see them, including imagining others' judgments.

Question 11: The Stroop effect, where naming ink color is slower when the word spells a different color, demonstrates which psychological phenomenon?

• Inattentional blindness
• Perceptual set
• Change blindness
• Selective attention and cognitive interference (Correct answer)

Correct answer: Selective attention and cognitive interference

The Stroop effect illustrates that automatic reading of words interferes with the controlled process of naming ink colors, demonstrating cognitive interference.

Question 12: In CRISPR-Cas9 gene editing, the guide RNA (gRNA) functions to:

• Methylate the target DNA to silence the gene
• Direct the Cas9 endonuclease to a specific genomic sequence via complementary base pairing (Correct answer)
• Synthesize a new complementary DNA strand at the target site
• Transcribe the target gene into mRNA

Correct answer: Direct the Cas9 endonuclease to a specific genomic sequence via complementary base pairing

The guide RNA contains a spacer sequence complementary to the target genomic DNA, directing Cas9 to the precise location where it introduces a double-strand break.

Question 13: A photon has a wavelength of 400 nm. What is its energy? (h = 6.63 × 10⁻³⁴ J·s, c = 3 × 10⁸ m/s)

• 1.66 × 10⁻¹⁹ J
• 9.94 × 10⁻¹⁹ J
• 3.31 × 10⁻¹⁹ J
• 4.97 × 10⁻¹⁹ J (Correct answer)

Correct answer: 4.97 × 10⁻¹⁹ J

E = hc/λ = (6.63 × 10⁻³⁴ × 3 × 10⁸) / (400 × 10⁻⁹) ≈ 4.97 × 10⁻¹⁹ J.

Question 14: A fluid flows through a pipe that narrows from a cross-sectional area of 0.04 m² to 0.01 m². If the velocity in the wide section is 2 m/s, what is the velocity in the narrow section?

• 0.5 m/s
• 16 m/s
• 4 m/s
• 8 m/s (Correct answer)

Correct answer: 8 m/s

By the continuity equation, A₁v₁ = A₂v₂: 0.04×2 = 0.01×v₂; v₂ = 8 m/s.

Question 15: What characterizes an aromatic compound according to Hückel's rule?

• It must be planar, cyclic, fully conjugated, and have 4n+2 π electrons (Correct answer)
• It must contain only carbon and hydrogen
• It must have alternating single and double bonds only
• It must have 4n π electrons

Correct answer: It must be planar, cyclic, fully conjugated, and have 4n+2 π electrons

Hückel's rule states that aromatic compounds are cyclic, planar, fully conjugated, and contain 4n+2 π electrons (where n is a non-negative integer).

Question 16: In the first paragraph, the author most usually omits particular details of the events in order to:

• set an expectation that is reversed in the following paragraph. (Correct answer)
• downplay the significance of the events being addressed.
• conceal a general lack of knowledge on the subject matter.
• express the primary thesis of the passage more concisely.

Correct answer: set an expectation that is reversed in the following paragraph.

The first paragraph describes popular uprisings against taxation and economic hardship, using language that strongly suggests the American Revolution. However, the second paragraph immediately clarifies, 'These popular uprisings... were not... revolts against the British monarchy... Rather, Shays' Rebellion... occurred after the British had been vanquished.' This deliberate setup and subsequent reversal of the reader's likely initial assumption is a rhetorical device to highlight the author's main point about post-Revolutionary rebellions.

Question 17: What is the first stage of cognitive development, according to Piaget?

• Formal Operational
• Concrete Operational
• Sensorimotor (Correct answer)
• Preoperational

Correct answer: Sensorimotor

Jean Piaget's theory of cognitive development outlines four stages. The sensorimotor stage is the first, occurring from birth to approximately two years of age. During this stage, infants learn about the world primarily through their senses and motor actions, developing object permanence and basic understanding of cause and effect.

Question 18: In Milgram's obedience studies, the factor most effective at reducing participants' compliance with authority was:

• Having two confederates refuse to continue (Correct answer)
• Removing the authority figure from the room
• Telling participants the study was about punishment
• Increasing the apparent pain of the victim

Correct answer: Having two confederates refuse to continue

When confederates modeling defiance were present, obedience rates dropped dramatically, showing social support for resistance reduces compliance.

Question 19: Two genes are said to be genetically linked when they are:

• Always segregating independently during meiosis
• Showing a 9:3:3:1 ratio in dihybrid crosses
• Located on the same chromosome (Correct answer)
• Located on different homologous chromosomes

Correct answer: Located on the same chromosome

Linked genes reside on the same chromosome and tend to be inherited together unless separated by crossing over during meiosis.

Question 20: According to Erikson's psychosocial stages, the central conflict of adolescence is:

• Intimacy vs. Isolation
• Identity vs. Role Confusion (Correct answer)
• Autonomy vs. Shame and Doubt
• Industry vs. Inferiority

Correct answer: Identity vs. Role Confusion

During adolescence (ages 12–18), Erikson's stage centers on forming a coherent identity versus experiencing confusion about one's role in society.

Question 21: A passage argues that mandatory voting would improve democratic outcomes. A critic responds that mandatory voting infringes on individual liberty. This objection is best described as:

• An appeal to authority citing constitutional scholars
• A counterargument based on a competing value not addressed by the author (Correct answer)
• An ad hominem attack on the author's political motives
• A straw man that misrepresents the author's proposal

Correct answer: A counterargument based on a competing value not addressed by the author

The critic introduces individual liberty as a value that competes with improved democratic outcomes, which the original argument had not weighed.

Question 22: Karl Marx proposed the Conflict Theory, which is founded on the idea that power determines how people interact in society. Which of the following assertions is the most accurate representation of the Conflict Theory?

• People act based on their past experiences to view society through a lens.
• Society agrees on the specific value of an item that otherwise would not have intrinsic worth.
• Society consists of one group of people who desire change and one group of people who are content with status quo. (Correct answer)
• Institutions will only change when they have to in order to meet demand and to the minimum necessary.

Correct answer: Society consists of one group of people who desire change and one group of people who are content with status quo.

Answer Explanation: (C) <br> C is the answer that most closely correlate to the Marx theory. In this theory, the group that is content with the status quo is the group in power. Answer B correlates closer to Functionalism, which states that institutions and the population exist in a balance. Answer D describes social constructionism. Answer A is consistent with symbolic interactionism, which at its heart states that the world is created by people interacting with it.

Question 23: The Circle of Willis is primarily supplied by which two sets of arteries?

• Internal carotid and external carotid arteries
• Vertebral and basilar arteries only
• Internal carotid arteries and vertebrobasilar system (Correct answer)
• External carotid and vertebral arteries

Correct answer: Internal carotid arteries and vertebrobasilar system

The Circle of Willis receives blood from the paired internal carotid arteries anteriorly and the vertebrobasilar system posteriorly.

Question 24: Which intermolecular force is responsible for the unusually high surface tension of water?

• London dispersion forces
• Hydrogen bonding (Correct answer)
• Dipole-dipole interactions
• Ion-dipole interactions

Correct answer: Hydrogen bonding

Water's extensive hydrogen bonding network creates strong cohesive forces between molecules, resulting in high surface tension.

Question 25: An individual comes to the clinic for an initial evaluation and to begin treatment. The patient was born as a 46-year-old man named XY, but she identifies as a woman. She/Her are her preferred pronouns. Furthermore, she is only sexually active with females. What would you use to characterize this person's gender and sexual orientation?

• Transgender, heterosexual
• Cis-gender, heterosexual
• Transgender, homosexual (Correct answer)
• Cis-gender, homosexual

Correct answer: Transgender, homosexual

Answer Explanation: (B) <br> Gender discussions are becoming increasingly important in the field of medicine as of late. In order to appropriately address this, these definitions have become more important. Gender is spoken of in relation to what biological sex the infant has, whereas sexual orientation is described in relation to the individual’s identified gender.

Question 26: Which of the following hormones is released by the adrenal medulla during the acute stress response?

• Epinephrine (Correct answer)
• Aldosterone
• Testosterone
• Cortisol

Correct answer: Epinephrine

The adrenal medulla releases epinephrine (and norepinephrine) as part of the fight-or-flight response, rapidly mobilizing energy and increasing heart rate.

Question 27: Conformity experiments by Solomon Asch demonstrated that individuals often conform to group judgments even when those judgments are clearly incorrect. Which factor most increases conformity in these situations?

• Increased group size beyond three members (Correct answer)
• High individual self-esteem
• Anonymous response format
• Presence of at least one other dissenter

Correct answer: Increased group size beyond three members

Asch found that conformity increased with group size up to about 3–5 members, after which additional members provided diminishing increases in conformity pressure.

Question 28: In E. coli, when glucose is absent and lactose is present, which statement best describes the state of the lac operon?

• The catabolite activator protein (CAP) remains inactive
• The operon is transcribed at high levels due to both positive and negative regulation (Correct answer)
• The lac structural genes are not transcribed
• The repressor binds the operator and blocks transcription

Correct answer: The operon is transcribed at high levels due to both positive and negative regulation

With glucose absent, cAMP levels rise and activate CAP to stimulate transcription; with lactose present, allolactose inactivates the repressor, resulting in high-level transcription of the lac operon.

Question 29: Which of the following compounds would have the highest boiling point?

• CH₃CH₂CH₃
• CH₃OH (Correct answer)
• CH₄
• CH₃CH₃

Correct answer: CH₃OH

Methanol (CH₃OH) has the highest boiling point because hydrogen bonding between OH groups is much stronger than the London dispersion forces in the hydrocarbons.

Question 30: A patient arrives at the emergency room very disturbed. They're acting irrationally and insisting they need medication or "terrible things" will happen if they don't. What is the most likely status of the dopamine system in this patient?

• There is decreased dopamine in the synaptic cleft.
• There is cell death in the areas with high dopamine cells.
• There is seizure-like activity in the dopamine brain areas.
• There are decreased dopamine receptors on the post-synaptic membrane. (Correct answer)

Correct answer: There are decreased dopamine receptors on the post-synaptic membrane.

The patient's irrational behavior and distress are highly suggestive of psychosis, often associated with disorders like schizophrenia. These conditions are linked to excessive dopamine activity in certain brain regions (hyperdopaminergia). While acute psychosis involves increased dopamine signaling, the brain can undergo compensatory changes, such as a downregulation or decrease in post-synaptic dopamine receptors, in response to chronic overstimulation to try and reduce the overall impact of high dopamine levels.

Question 31: Which branch of the brachial plexus innervates the coracobrachialis, biceps brachii, and brachialis?

• Musculocutaneous nerve (Correct answer)
• Axillary nerve
• Median nerve
• Radial nerve

Correct answer: Musculocutaneous nerve

The musculocutaneous nerve (C5-C7) innervates all three muscles of the anterior compartment of the arm before continuing as the lateral cutaneous nerve of the forearm.

Question 32: Tom is a nationally recognized cellist who has recently accepted a scholarship to play in the orchestra at a prominent university. He was handed a package of sheet music during the summer to master by the fall semester. When it comes to his work, Tom is a perfectionist. He constantly compares himself to better musicians and is quite critical of himself when a section of one of his pieces is not mastered. Which of the following statements most accurately describes Tom?

• Low self-esteem, strong self-efficacy, external locus of control
• Low self-esteem, low self-efficacy, internal locus of control
• High self-esteem, strong self-efficacy, internal locus of control
• Low self-esteem, strong self-efficacy, internal locus of control (Correct answer)

Correct answer: Low self-esteem, strong self-efficacy, internal locus of control

Answer Explanation: (B) <br> It is important to remember for these questions that self-efficacy refers to a specific task, whereas self-esteem refers to the respect one has for themselves. Perfectionists, especially those who are known to be hard on themselves, often have an internal locus of control, blaming themselves for failures.

Question 33: Which of the following statements about Le Chatelier's principle is correct when pressure is increased on the equilibrium N₂(g) + 3H₂(g) ⇌ 2NH₃(g)?

• Equilibrium shifts right to produce fewer moles of gas (Correct answer)
• Equilibrium shifts right because ammonia is the product
• Equilibrium is unaffected because the reaction involves only gases
• Equilibrium shifts left to produce more moles of gas

Correct answer: Equilibrium shifts right to produce fewer moles of gas

Increasing pressure favors the side with fewer moles of gas; 4 moles of reactant gas form 2 moles of NH₃, so equilibrium shifts right.

Question 34: Which of the following was a likely basis for the creation of the 22nd Amendment?

• The oppression by a monarchy previously was an example of abuse of power. (Correct answer)
• Interstate trade was shown to improve the growth of an overall national economy.
• The system of checks and balances prevents power from being held by any one branch.
• Citizens never wanted to be subject to the government’s force.

Correct answer: The oppression by a monarchy previously was an example of abuse of power.

The passage notes that the 22nd Amendment limited presidents to two terms, stating 'Originally presidents were eligible for continual reelection.' This restriction on executive power reflects a historical concern about the concentration of power and potential for tyranny, similar to the abuses associated with monarchies. The American Revolution was fought against a monarchy, and limiting presidential terms helps prevent a similar long-term hold on power.

Question 35: In MCAT practice, what is the best approach to quality improvement in sociology?

• Copy what other organizations do without analysis
• Use data-driven methods with measurable outcomes (Correct answer)
• Make changes without measuring results
• Wait for problems to occur before acting

Correct answer: Use data-driven methods with measurable outcomes

Data-driven quality improvement with measurable outcomes ensures that changes actually produce the intended improvements and can be verified.

Question 36: During REM sleep, the brain exhibits which of the following EEG patterns?

• Theta waves only
• Sleep spindles and K-complexes
• High-amplitude, low-frequency delta waves
• Low-amplitude, high-frequency waves similar to waking (Correct answer)

Correct answer: Low-amplitude, high-frequency waves similar to waking

REM sleep shows desynchronized, low-amplitude, high-frequency EEG activity resembling an awake brain, along with rapid eye movements and muscle atonia.

Question 37: In MCAT science preparation, what does homeostasis refer to?

• Energy production
• Cell division
• The tendency to maintain stable internal conditions (Correct answer)
• Rapid growth

Correct answer: The tendency to maintain stable internal conditions

Homeostasis is the process by which organisms maintain stable internal conditions necessary for survival despite external changes.

Question 38: To survive, humans need a lot of help from the outside world. Without water, air, and other essentials, no one can survive. Thankfully, the human brain is programmed to seek out these resources as they become exhausted, preventing injury to the individual. However, the downside is that they can provide too much incentive and hence become a source of temptation. Which of the following statements best describes when a desire has turned into a temptation?

• A free diver delays leaving the beach after a dive by a few minutes in order to regain their breath.
• A person desiring to lose weight makes a late night snack to quell a craving.
• A person pauses their show on TV in order to grab a blanket because they are cold.
• A marathon runner seeks out water after finishing a race.

Answer Explanation: <br> Desires become temptations when they conflict with longer-term goals in order to satisfy short-term desires. A, C, and D are all desires that improve the individual’s long term outcome. Only A sacrifices the long-term goal for the short term.

Question 39: Which process allows a single gene to produce multiple protein isoforms from the same pre-mRNA?

• Alternative splicing (Correct answer)
• RNA editing
• Histone acetylation
• DNA methylation

Correct answer: Alternative splicing

Alternative splicing allows different combinations of exons to be included or excluded, producing multiple distinct mRNA and protein isoforms from a single gene.

Question 40: A wave on a string has a frequency of 50 Hz and a wavelength of 0.4 m. What is the wave speed?

• 20 m/s (Correct answer)
• 50 m/s
• 125 m/s
• 0.008 m/s

Correct answer: 20 m/s

Wave speed v = fλ = 50 × 0.4 = 20 m/s.

Question 41: A CARS question asks what the author would most likely agree with. The passage argues that economic growth metrics ignore environmental costs. The best answer would be:

• International bodies should set binding emissions limits on all nations
• Environmental protection always takes precedence over economic development
• Standard economic metrics are inadequate because they exclude ecological damage (Correct answer)
• GDP growth should be pursued even when it harms ecosystems

Correct answer: Standard economic metrics are inadequate because they exclude ecological damage

The author's central point is about the inadequacy of existing growth metrics, not a sweeping prioritization of environment over economy or a specific policy mandate.

Question 42: Which factor is most important when evaluating the quality of scientific research for MCAT?

• Reputation of the authors
• Methodology, sample size, and peer review status (Correct answer)
• Length of the study report
• Number of references cited

Correct answer: Methodology, sample size, and peer review status

Research quality is best evaluated by examining the methodology, adequacy of sample size, and whether the study has undergone peer review.

Question 43: Which sensory system is primarily responsible for detecting the body's position and movement in space?

• Proprioceptive system (Correct answer)
• Olfactory system
• Somatosensory system
• Vestibular system

Correct answer: Proprioceptive system

Proprioception involves sensory receptors in muscles, tendons, and joints that signal body position and movement to the central nervous system.

Question 44: Which event occurs during the S phase of the cell cycle?

• Cytokinesis
• DNA replication (Correct answer)
• Spindle formation
• Chromosome condensation

Correct answer: DNA replication

During the S (synthesis) phase of interphase, the entire genome is replicated so that each chromosome consists of two identical sister chromatids.

Question 45: The Constitution concisely organizes the country’s basic political institutions. The main text comprises seven articles. Article I vests all legislative powers in the Congress—the House of Representatives and the Senate. The Great Compromise stipulated that representation in the House would be based on population, and each state is entitled to two senators. Members of the House serve terms of two years, senators terms of six. Among the powers delegated to Congress are the right to levy taxes, borrow money, regulate interstate commerce, provide for military forces, declare war, and determine member seating and rules of procedure. The House initiates impeachment proceedings, and the Senate adjudicates them. <br> Article II vests executive power in the office of the presidency of the United States. The president, selected by an electoral college to serve a four-year term, is given responsibilities common to chief executives, including serving as commander in chief of the armed forces, negotiating treaties (two-thirds of the Senate must concur), and granting pardons. The president’s vast appointment powers, which include members of the federal judiciary and the cabinet, are subject to the “advice and consent” (majority approval) of the Senate (Article II, Section 2). Originally presidents were eligible for continual reelection, but the Twenty-second Amendment (1951) later prohibited any person from being elected president more than twice. Although the formal powers of the president are constitutionally quite limited and vague in comparison with those of the Congress, a variety of historical and technological factors—such as the centralization of power in the executive branch during war and the advent of television—have increased the informal responsibilities of the office extensively to embrace other aspects of political leadership, including proposing legislation to Congress. <br> The federal government is obliged by many constitutional provisions to respect the individual citizen’s basic rights. Some civil liberties were specified in the original document, notably in the provisions guaranteeing the writ of habeas corpus and trial by jury in criminal cases (Article III, Section 2) and forbidding bills of attainder and ex post facto laws (Article I, Section 9). But the most significant limitations to government’s power over the individual were added in 1791 in the Bill of Rights. The Constitution’s First Amendment guarantees the rights of conscience, such as freedom of religion, speech, and the press, and the right of peaceful assembly and petition. Other guarantees in the Bill of Rights require fair procedures for persons accused of a crime—such as protection against unreasonable search and seizure, compulsory self-incrimination, double jeopardy, and excessive bail—and guarantees of a speedy and public trial by a local, impartial jury before an impartial judge and representation by counsel. Rights of private property are also guaranteed. Although the Bill of Rights is a is a broad expression of individual civil liberties, the ambiguous wording of many of its provisions—such as the Second Amendment’s right “to keep and bear arms” and the Eighth Amendment’s prohibition of “cruel and unusual punishments”—has been a source of constitutional controversy and intense political debate. Further, the rights guaranteed are not absolute, and there has been considerable disagreement about the extent to which they limit governmental authority. The Bill of Rights originally protected citizens only from the national government. For example, although the Constitution prohibited the establishment of an official religion at the national level, the official state-supported religion of Massachusetts was Congregationalism until 1833. Thus, individual citizens had to look to state constitutions for protection of their rights against state governments. <br> During the early stages of the Afghan War, intelligence agencies used psychological techniques such as sleep deprivation and waterboarding on interrogated captives. Which section of the constitution, according to the report, would prevent this from happening to American citizens?

• Article III
• Article I
• Eighth Amendment (Correct answer)
• Second Amendment

Correct answer: Eighth Amendment

The passage explicitly mentions the 'Eighth Amendment’s prohibition of 'cruel and unusual punishments'' as a guarantee within the Bill of Rights. Sleep deprivation and waterboarding are widely considered forms of torture or cruel and unusual punishment. Therefore, this amendment would be the constitutional provision designed to prevent such practices from being inflicted upon American citizens.

Question 46: What is the stereochemical outcome of an SN2 reaction?

• Inversion of configuration (Walden inversion) (Correct answer)
• Racemization
• Random mixture of products
• Retention of configuration

Correct answer: Inversion of configuration (Walden inversion)

SN2 proceeds via a backside attack transition state, resulting in inversion of configuration at the chiral center (Walden inversion).

Question 47: Who is the Sphinx that the writer is referring to in this passage?

• The spirit of a lie.
• A statue of stoic nature.
• A representative of those that answer questions.
• A representative of those that ask questions. (Correct answer)

Correct answer: A representative of those that ask questions.

The passage explicitly states, 'That this Sphinx teaches us at last to ask questions ourselves? WHO is it really that puts questions to us here?'. This directly links the Sphinx to the act of posing questions. In Greek mythology, the Sphinx is known for asking riddles, further solidifying its role as a representative of those who ask challenging questions.

Question 48: Which phase of meiosis is responsible for genetic recombination through crossing over?

• Anaphase I
• Metaphase II
• Telophase II
• Prophase I (Correct answer)

Correct answer: Prophase I

Crossing over between homologous chromosomes occurs during Prophase I of meiosis, at the tetrad stage (synapsis), increasing genetic diversity.

Question 49: Sauna use, sometimes referred to as "sauna bathing," is characterized by short-term passive exposure to extreme heat. This exposure elicits mild hyperthermia – an increase in the body's core temperature – that induces a thermoregulatory response involving neuroendocrine, cardiovascular, and cytoprotective mechanisms that work together to restore homeostasis and condition the body for future heat stressors… In recent decades, sauna bathing has emerged as a means to increase lifespan and improve overall health, based on compelling data from observational, interventional, and mechanistic studies. Of particular interest are the findings from studies of participants in the Kuopio Ischemic Heart Disease Risk Factor (KIHD) Study, an ongoing prospective population-based cohort study of health outcomes in more than 2,300 middle-aged men from eastern Finland, which identified strong links between sauna use and reduced death and disease… The KIHD findings showed that men who used the sauna two to three times per week were 27 percent less likely to die from cardiovascular-related causes than men who didn't use the sauna.[2] Furthermore, the benefits they experienced were found to be dose-dependent: Men who used the sauna roughly twice as often, about four to seven times per week, experienced roughly twice the benefits – and were 50 percent less likely to die from cardiovascular-related causes.[2] In addition, frequent sauna users were found to be 40 percent less likely to die from all causes of premature death. These findings held true even when considering age, activity levels, and lifestyle factors that might have influenced the men's health.[2]... The KIHD also revealed that frequent sauna use reduced the risk of developing dementia and Alzheimer's disease in a dose-dependent manner. Men who used the sauna two to three times per week had a 66 percent lower risk of developing dementia and a 65 percent lower risk of developing Alzheimer's disease, compared to men who used the sauna only one time per week… The health benefits associated with sauna use extended to other aspects of mental health, as well. Men participating in the KIHD study who used the sauna four to seven times per week were 77 percent less likely to develop psychotic disorders, regardless of the men's dietary habits, socioeconomic status, physical activity, and inflammatory status (as measured by C-reactive protein)…Exposure to high temperature stresses the body, eliciting a rapid, robust response. The skin and core body temperatures increase markedly, and sweating ensues. The skin heats first, rising to 40°C (104°F), and then changes in core body temperature occur, rising slowly from 37°C (98.6°F, or normal) to 38°C (100.4°F) and then rapidly increasing to 39°C (102.2°F)… Cardiac output, a measure of the amount of work the heart performs in response to the body's need for oxygen, increases by 60 to 70 percent, while the heart rate (the number of beats per minute) increases and the stroke volume (the amount of blood pumped) remains unchanged.[5] During this time, approximately 50 to 70 percent of the body's blood flow is redistributed from the core to the skin to facilitate sweating. The average person loses approximately 0.5 kg of sweat while sauna bathing.[11] Acute heat exposure also induces a transient increase in overall plasma volume to mitigate the decrease in core blood volume. This increase in plasma volume not only provides a reserve source of fluid for sweating, but it also acts like the water in a car's radiator, cooling the body to prevent rapid increases in core body temperature and promoting heat tolerance… Repeated sauna use acclimates the body to heat and optimizes the body's response to future exposures, likely due to a biological phenomenon known as hormesis, a compensatory defense response following exposure to a mild stressor that is disproportionate to the magnitude of the stressor. Hormesis triggers a vast array of protective mechanisms that not only repair cell damage but also provide protection from subsequent exposures to more devastating stressors… The physiological responses to sauna use are remarkably similar to those experienced during moderate- to vigorous-intensity exercise. In fact, sauna use has been proposed as an alternative to exercise for people who are unable to engage in physical activity due to chronic disease or physical limitations.[13] <br> Which of the following is NOT an advantage of sauna use, according to the article?

• Increase in stroke volume.
• Improved mental health.
• Decreased rate of erectile dysfunction. (Correct answer)
• Decreased risk of heart attacks.

Correct answer: Decreased rate of erectile dysfunction.

The article explicitly mentions several advantages of sauna use, including improved mental health (reduced risk of dementia, Alzheimer's, psychotic disorders), decreased risk of heart attacks (reduced cardiovascular-related causes of death), and an increase in cardiac output. However, there is no mention or discussion of erectile dysfunction or its rate anywhere in the provided text. While cardiac output increases, the article states stroke volume remains unchanged.

Question 50: Which theory of emotion proposes that physiological arousal and the cognitive label applied to that arousal together produce the emotional experience?

• Cannon-Bard theory
• Lazarus cognitive appraisal theory
• Schachter-Singer two-factor theory (Correct answer)
• James-Lange theory

Correct answer: Schachter-Singer two-factor theory

The Schachter-Singer two-factor theory holds that emotion = physiological arousal + cognitive label assigned to explain that arousal.

Question 51: A child watches an adult punch a doll and later imitates this behavior. This best demonstrates:

• Insight learning
• Classical conditioning
• Observational (social) learning (Correct answer)
• Operant conditioning

Correct answer: Observational (social) learning

Bandura's Bobo doll experiments showed that children learn aggressive behaviors by observing and imitating models, illustrating observational learning.

Question 52: On a weekday, a psychology study was set up directly outside the gym on a college campus. Chocolate chip cookies were handed out directly outside the door, and a sign was posted 15 feet down the hall asking visitors to avoid taking the stairs, forcing them to walk around in a longer corridor. Apart from the warning, there were no obstacles to accessing the stairs. The results showed that those who accepted a sweet from the platter were twice as likely to use the longer hallway than those who rejected. What psychological notion is this an illustration of?

• Insecure attachment
• Tyranny of choice
• Learned helplessness
• Ego depletion (Correct answer)

Correct answer: Ego depletion

Answer Explanation: (A) <br> This question tests the concept of ego depletion. Ego depletion is the theory that self control is an exhaustible resource, and that, in individuals who are tested on their self control, they will be less and less likely to resist temptations in sequential order. In this study, the students who refused the cookie then had less self control to avoid using the stairs.

Question 53: In Merton's strain theory, an individual who rejects both the cultural goals of society and the legitimate means to achieve them, then substitutes new goals and means, is classified as a:

• Rebel (Correct answer)
• Retreatist
• Innovator
• Ritualist

Correct answer: Rebel

Rebels reject society's goals and means and actively seek to replace them with alternative ones, as seen in revolutionary social movements.

Question 54: A CARS passage on classical music argues that its declining audience reflects cultural elitism rather than musical quality. An inference that follows from this argument is that:

• Musical quality is impossible to evaluate objectively
• Classical music is objectively superior to popular music
• Classical musicians should adopt popular music techniques to survive
• Widening access to classical music venues could expand its audience (Correct answer)

Correct answer: Widening access to classical music venues could expand its audience

If elitist access barriers rather than quality explain the decline, removing those barriers would logically be expected to grow the audience.

Question 55: A researcher studies how repeated exposure to a neutral stimulus paired with a fear-inducing stimulus eventually causes the neutral stimulus alone to elicit fear. Which learning paradigm best describes this?

• Observational learning
• Operant conditioning
• Habituation
• Classical conditioning (Correct answer)

Correct answer: Classical conditioning

Classical conditioning pairs a neutral conditioned stimulus with an unconditioned stimulus until the neutral stimulus alone elicits a conditioned response.

Question 56: Which of the following statements best describes the concept "HOW COULD SOMETHING ORIGINATE FROM IT'S OPPOSITE?" It's impossible for such a genesis to occur.”

• A deer and a mouse cannot be compared.
• Some people possess the knowledge of what is truth, and others never can.
• Light cannot be considered good just because it gets rid of darkness. (Correct answer)
• Two lies must have something in common.

Correct answer: Light cannot be considered good just because it gets rid of darkness.

The passage critiques metaphysicians for believing that 'things of the highest value must have a different origin, an origin of THEIR own' and cannot originate from their opposites (e.g., truth from error). This implies that metaphysicians would argue that good things possess an inherent goodness, not merely the absence of bad. Therefore, stating that 'Light cannot be considered good just because it gets rid of darkness' aligns with the metaphysicians' view that good has an independent, inherent origin, which the author then challenges.

Question 57: In the context of MCAT, what does evidence-based practice mean?

• Integrating current best evidence with professional expertise (Correct answer)
• Ignoring research findings
• Using outdated methods because they are familiar
• Following only personal experience

Correct answer: Integrating current best evidence with professional expertise

Evidence-based practice integrates the best available research evidence with professional expertise and patient values for optimal outcomes.

Question 58: A solution contains 0.1 mol/L of a weak acid with Ka = 1×10⁻⁵. What is the approximate pH?

• 5.0
• 3.0 (Correct answer)
• 7.0
• 1.0

Correct answer: 3.0

For a weak acid, [H⁺] ≈ √(Ka × C) = √(1×10⁻⁵ × 0.1) = √(1×10⁻⁶) = 1×10⁻³, so pH = 3.

Question 59: Which base pairing rule describes complementary DNA strands?

• A pairs with T, G pairs with C (Correct answer)
• A pairs with U, G pairs with C
• A pairs with C, G pairs with T
• A pairs with G, T pairs with C

Correct answer: A pairs with T, G pairs with C

In DNA, adenine (A) pairs with thymine (T) via two hydrogen bonds, and guanine (G) pairs with cytosine (C) via three hydrogen bonds (Chargaff's rules).

Question 60: A first-generation college student who excels academically but struggles to network with professors due to not knowing unwritten professional norms is experiencing a deficit in:

• Social capital
• Economic capital
• Cultural capital (Correct answer)
• Human capital

Correct answer: Cultural capital

Cultural capital includes the knowledge, behaviors, and skills that confer advantages in navigating institutions like higher education, which first-generation students may lack.

Question 61: Which of the following enzyme kinetics statements is FALSE?

• An increase in the substrate concentration (at constant enzyme concentration) leads to proportional increases in the rate of the reaction. (Correct answer)
• Maximal activity of many human enzymes occurs around pH 7.4.
• An enzyme–substrate complex can either form a product or dissociate back into the enzyme and substrate.
• Most enzymes operating in the human body work best at a temperature of 37°C.

Correct answer: An increase in the substrate concentration (at constant enzyme concentration) leads to proportional increases in the rate of the reaction.

At low substrate concentrations, increasing substrate does lead to a proportional increase in reaction rate. However, as substrate concentration continues to increase, the enzyme active sites become saturated. Once saturation is reached, further increases in substrate concentration will no longer proportionally increase the reaction rate, as the enzyme is working at its maximal velocity (Vmax). Therefore, the statement that increases are *proportional* at all substrate concentrations is false.

Question 62: How many grams of carbon dioxide would arise from a reaction with 84 grams of ethane and infinite oxygen (Carbon atomic weight: 12amu, Hydrogen atomic weight: 1amu, Oxygen atomic weight: 16amu) using this formula? <br> The following is the imbalanced ethane gas reaction with carbon dioxide and water: <br> CO2 + H2O (C2H4 + O2)

• 156g
• 528g
• 264g (Correct answer)
• 78g

Correct answer: 264g

First, balance the combustion reaction for ethene (C2H4): C2H4 + 3O2 → 2CO2 + 2H2O. Next, calculate the molar mass of C2H4, which is 28 g/mol. Given 84 grams of C2H4, this corresponds to 3 moles (84g / 28g/mol). According to the balanced equation, 1 mole of C2H4 produces 2 moles of CO2. Therefore, 3 moles of C2H4 will produce 6 moles of CO2. Finally, calculate the mass of 6 moles of CO2 (molar mass 44 g/mol): 6 moles * 44 g/mol = 264 grams.

Question 63: Which neurotransmitter is primarily implicated in the reward pathway and is significantly elevated during pleasurable activities, playing a central role in addiction?

• GABA
• Norepinephrine
• Dopamine (Correct answer)
• Serotonin

Correct answer: Dopamine

Dopamine is the primary neurotransmitter in the mesolimbic reward pathway, and its release during pleasurable activities underlies the reinforcing nature of addictive substances.

Question 64: A protein has a Km of 2 mM and a Vmax of 100 μmol/min. At a substrate concentration of 2 mM, what is the reaction velocity?

• 25 μmol/min
• 75 μmol/min
• 50 μmol/min (Correct answer)
• 100 μmol/min

Correct answer: 50 μmol/min

By the Michaelis-Menten equation, v = Vmax[S]/(Km+[S]) = 100×2/(2+2) = 50 μmol/min; at [S]=Km, velocity is always Vmax/2.

Question 65: In Piaget's theory, the process of modifying an existing schema to incorporate new information that doesn't fit is called:

• Equilibration
• Accommodation (Correct answer)
• Object permanence
• Assimilation

Correct answer: Accommodation

Accommodation involves changing or creating new schemas when new information cannot be assimilated into existing cognitive structures.

Question 66: Sensory adaptation is best illustrated by which of the following examples?

• Flinching at an unexpected loud sound
• No longer noticing the smell of a bakery after being inside for 20 minutes (Correct answer)
• Becoming more sensitive to pain after an injury
• A rat learning to press a lever for food pellets

Correct answer: No longer noticing the smell of a bakery after being inside for 20 minutes

Sensory adaptation refers to the diminished sensitivity to a constant stimulus over time, as receptor firing decreases with prolonged exposure.

Question 67: A passage argues that the peer review system in science, while imperfect, remains the best available mechanism for quality control. The author's attitude toward peer review is best described as:

• Qualified endorsement that acknowledges flaws while defending its utility (Correct answer)
• Uncritically enthusiastic and without reservation
• Neutral and descriptive without taking a position
• Skeptical and calling for its replacement with open review

Correct answer: Qualified endorsement that acknowledges flaws while defending its utility

Phrases like 'while imperfect, remains the best' signal qualified endorsement: the author sees flaws but still defends the system's value.

Question 68: A study finds that people perform better on simple tasks when others are present, but worse on complex tasks. This phenomenon is called:

• Social loafing
• Deindividuation
• Social facilitation (Correct answer)
• Groupthink

Correct answer: Social facilitation

Social facilitation refers to the tendency for the presence of others to enhance performance on well-learned tasks and impair performance on difficult or novel tasks.

Question 69: A researcher finds that as ice cream sales increase, drowning rates also increase. The most likely explanation is:

• Drowning victims often had ice cream beforehand
• Ice cream consumption causes dehydration, increasing drowning risk
• Both variables increase in summer, making temperature a confounding variable (Correct answer)
• The correlation proves a causal relationship between ice cream and drowning

Correct answer: Both variables increase in summer, making temperature a confounding variable

This is a classic example of a spurious correlation driven by a confounding variable (season/temperature) that independently increases both ice cream consumption and swimming-related drowning.

Question 70: A health disparity is observed where Black Americans have significantly higher rates of hypertension than white Americans. Which social determinant most directly explains this difference?

• Genetic predisposition unrelated to environment
• Chronic stress from racial discrimination and socioeconomic inequality (Correct answer)
• Biological inability to metabolize antihypertensives
• Lack of interest in healthcare among Black communities

Correct answer: Chronic stress from racial discrimination and socioeconomic inequality

Chronic psychosocial stress from racism, discrimination, and socioeconomic disadvantage is a major driver of hypertension disparities in Black Americans.

Question 71: What are the author's thoughts on the philosophers of his era?

• He believes they have answered all the questions they can of this time.
• He believes that they hold too much power.
• He believes there is an emerging wave of philosophers who believe in the definition of truth by its opposite. (Correct answer)
• He believes there are too few philosophers asking questions.

Correct answer: He believes there is an emerging wave of philosophers who believe in the definition of truth by its opposite.

The author criticizes 'metaphysicians of all times' for their 'belief in antitheses of values' and their failure to question whether 'truth out of error' or 'generous deed out of selfishness' is possible. He then expresses anticipation for 'new philosophers beginning to appear' who will embrace 'dangerous 'Perhapses'' and explore the possibility that good and evil are 'essentially identical.' This indicates the author believes a new wave of thinkers will challenge the traditional separation of values and explore the interconnectedness of apparent opposites.

Question 72: Which sociological perspective would most likely argue that the healthcare system perpetuates inequality by serving the interests of the wealthy and pharmaceutical companies?

• Conflict theory (Correct answer)
• Symbolic interactionism
• Social exchange theory
• Functionalism

Correct answer: Conflict theory

Conflict theory views social institutions, including healthcare, as structures that maintain power imbalances and serve the interests of dominant groups.

Question 73: Which sociological concept describes the process by which individuals learn the norms, values, and behaviors appropriate to their culture?

• Acculturation
• Socialization (Correct answer)
• Assimilation
• Stratification

Correct answer: Socialization

Socialization is the lifelong process through which individuals internalize the norms, values, and roles of their society.

Question 74: According to Erikson's psychosocial stages, the central conflict for adolescents (ages 12–18) is best described as:

• Intimacy vs. Isolation
• Identity vs. Role Confusion (Correct answer)
• Autonomy vs. Shame and Doubt
• Industry vs. Inferiority

Correct answer: Identity vs. Role Confusion

Erikson's fifth stage, Identity vs. Role Confusion, occurs during adolescence and involves developing a coherent sense of self.

Question 75: Which of the following best illustrates the concept of 'relative deprivation'?

• A person who lacks clean water and sufficient food in a developing nation
• A factory worker who feels poor after moving to a wealthy neighborhood, despite earning the same income (Correct answer)
• A student who performs below average compared to national standards
• An unemployed individual who cannot afford basic necessities

Correct answer: A factory worker who feels poor after moving to a wealthy neighborhood, despite earning the same income

Relative deprivation is the subjective sense of disadvantage experienced when individuals compare themselves to a reference group that has more.

Question 76: In a series circuit, two resistors of 4 Ω and 6 Ω are connected to a 20 V battery. What is the current through the circuit?

• 4 A
• 1 A
• 5 A
• 2 A (Correct answer)

Correct answer: 2 A

Total resistance = 4 + 6 = 10 Ω; current I = V/R = 20/10 = 2 A.

Question 77: Which of the following is an example of a nucleophile in organic chemistry?

• AlCl₃
• H₂O (Correct answer)
• H⁺
• BF₃

Correct answer: H₂O

Water (H₂O) is a nucleophile because it has lone pairs of electrons on oxygen that it can donate to electrophilic carbon atoms.

Question 78: Which of the following statements is the author most likely to agree with based on the article?

• Patients on a diet would benefit from sauna use.
• Patients with skin conditions may be cured with sauna use.
• Salt restriction would be equal to sauna use for hypertensive patients.
• Heart surgery patients who cannot run on treadmills may benefit from sauna use. (Correct answer)

Correct answer: Heart surgery patients who cannot run on treadmills may benefit from sauna use.

The article explicitly states that 'sauna use has been proposed as an alternative to exercise for people who are unable to engage in physical activity due to chronic disease or physical limitations.' Heart surgery patients often have physical limitations that prevent them from performing strenuous activities like running on a treadmill. Therefore, the author would likely agree that sauna use could be a beneficial alternative for such individuals to gain exercise-like benefits.

Question 79: A hospital notices that patients with lower health literacy are less likely to follow discharge instructions, leading to higher readmission rates. A functionalist would most likely attribute this pattern to:

• Corporate profit motives in the healthcare system
• Individual laziness and lack of motivation to follow medical advice
• A mismatch between institutional communication norms and patients' cultural backgrounds (Correct answer)
• Deliberate exclusion of low-literacy patients from quality care

Correct answer: A mismatch between institutional communication norms and patients' cultural backgrounds

Functionalism emphasizes how different parts of the social system must work together; health literacy gaps represent a dysfunction between healthcare institutions and patient populations.

Question 80: Samantha is a college student who is working with her therapist to improve her self-esteem and self-efficacy. After three months of counseling, she has observed a significant improvement in her capacity to handle problems. Which of the following is NOT an approach her therapist would recommend for increasing her sense of self-efficacy?

• Put in daily practice on the tasks she wishes to improve on.
• Find others her age and ability who excel at tasks she is interested in.
• Seek positive feedback from friends.
• Avoid potential pitfalls by withholding from tasks she is not proficient in. (Correct answer)

Correct answer: Avoid potential pitfalls by withholding from tasks she is not proficient in.

Answer Explanation: (A) <br> Self-efficacy correlates most closely to a person’s sense of ability within a specific set of tasks. The four known ways to improve self-efficacy are mastery of experience, social modeling, social persuasion, and psychological responses. Avoiding tasks, however, is an indication of weak self-efficacy.

Question 81: Which statement concerning fat-soluble vitamins is correct? <br> I. Vitamin D protects against cancer because it is a biological antioxidant. <br> II. Vitamin K is necessary for the posttranslational introduction of calcium-binding sites. <br> III. Vitamin A is metabolized to retinal, which is important for sight. <br> IV. Vitamin E is important for calcium regulation.

• II and III only (Correct answer)
• I only
• II and IV only
• I and IV only

Correct answer: II and III only

Vitamin K is essential for the post-translational modification of clotting factors, specifically the carboxylation of glutamate residues, which creates calcium-binding sites necessary for coagulation. Vitamin A is metabolized to retinal, a component of rhodopsin, which is crucial for vision. Therefore, statements II and III are correct.

Question 82: The parotid duct (Stensen's duct) pierces which muscle to enter the oral cavity?

• Buccinator (Correct answer)
• Masseter
• Medial pterygoid
• Superior pharyngeal constrictor

Correct answer: Buccinator

The parotid duct travels anteriorly, turns medially to pierce the buccinator muscle, and opens opposite the upper second molar.

Question 83: The saphenous nerve, the largest cutaneous branch of the femoral nerve, accompanies which vessel in the leg?

• Small saphenous vein
• Great saphenous vein (Correct answer)
• Popliteal artery
• Posterior tibial artery

Correct answer: Great saphenous vein

The saphenous nerve runs with the great saphenous vein along the medial aspect of the leg, providing cutaneous innervation to the medial leg and foot.

Question 84: Which stimulus has the most impact on circadian rhythms?

• pain
• temperature
• light (Correct answer)
• pressure

Correct answer: light

Light is the most significant environmental cue, or zeitgeber, that influences and synchronizes our circadian rhythms. Specialized photoreceptors in the retina detect light and send signals to the suprachiasmatic nucleus (SCN) in the hypothalamus, which acts as the body's master clock, regulating sleep-wake cycles and other biological processes.

Question 85: Which of the following is an example of a negative reinforcement schedule?

• Removing a loud alarm when a driver buckles their seatbelt (Correct answer)
• Sending a child to time-out for misbehavior
• Taking away TV privileges for poor grades
• Giving a child candy for completing homework

Correct answer: Removing a loud alarm when a driver buckles their seatbelt

Negative reinforcement increases a behavior by removing an aversive stimulus; buckling the seatbelt (behavior) is reinforced by stopping the alarm (removal of aversive stimulus).

Question 86: A radioactive isotope has a half-life of 5 years. What fraction of the original sample remains after 20 years?

• 1/4
• 1/2
• 1/8
• 1/16 (Correct answer)

Correct answer: 1/16

20 years = 4 half-lives; remaining fraction = (1/2)⁴ = 1/16.

Question 87: A surgeon who has operated thousands of times can perform routine incisions while simultaneously planning the next surgical step. This demonstrates which concept?

• Divided attention failure
• Automaticity through procedural learning (Correct answer)
• Explicit memory consolidation
• Dual process theory — System 2 thinking

Correct answer: Automaticity through procedural learning

Automaticity occurs when a skill becomes so well-practiced it requires minimal conscious attention, freeing cognitive resources for other tasks.

Question 88: An economist's passage claims that rent control reduces housing supply in the long run. A city planner counters that rent control preserves affordable housing in the short run. These two positions:

• Are mutually exclusive and cannot both be true
• Operate on different time horizons and may both be correct within their own frames (Correct answer)
• Are based on incompatible definitions of 'affordable housing'
• Agree that rent control is ultimately beneficial for low-income residents

Correct answer: Operate on different time horizons and may both be correct within their own frames

The economist addresses long-run supply effects while the planner addresses short-run affordability; both claims can be true simultaneously because they address different time frames.

Question 89: Phenylketonuria (PKU) is caused by a deficiency of which enzyme?

• Homogentisate dioxygenase
• Phenylalanine hydroxylase (Correct answer)
• Fumarylacetoacetase
• Tyrosine hydroxylase

Correct answer: Phenylalanine hydroxylase

PKU results from a loss-of-function mutation in phenylalanine hydroxylase, which normally converts phenylalanine to tyrosine; deficiency leads to phenylalanine accumulation and neurotoxic metabolite production.

Question 90: Which of the following is an example of a master status?

• Participating in a religious community while also working full-time
• Holding multiple social roles simultaneously
• Being identified primarily as 'the cancer patient' rather than as a professional or parent (Correct answer)
• Changing careers at midlife

Correct answer: Being identified primarily as 'the cancer patient' rather than as a professional or parent

A master status is a social position that overrides all other statuses a person holds, as when a serious illness becomes the defining characteristic others use to identify someone.

Question 91: A sociologist observes that people in higher socioeconomic classes have better access to healthcare, education, and nutrition. This pattern is best explained by which concept?

• Social loafing
• Social stratification (Correct answer)
• Relative deprivation
• Social mobility

Correct answer: Social stratification

Social stratification refers to the hierarchical ranking of individuals or groups in society based on wealth, power, and prestige, leading to differential access to resources.

Question 92: A CARS passage contrasts two historians' interpretations of the same event. One emphasizes economic causes; the other emphasizes ideological causes. The passage most likely intends to illustrate:

• That economic explanations are always superior to ideological ones
• That historical interpretation depends on the theoretical framework the historian employs (Correct answer)
• That the event in question has no single definitive cause
• That professional historians rarely agree on basic facts

Correct answer: That historical interpretation depends on the theoretical framework the historian employs

Presenting competing interpretations is a classic device to show how a scholar's guiding framework shapes what they emphasize and conclude.

Question 93: The review research draws heavily on data from population studies in Finland, where sauna use is far higher than in most other nations. Which of the following is more feasible in Finland than elsewhere, based on the data?

• More gold medals in adolescent skiing.
• An 86-year old male mayor who is revered in the community. (Correct answer)
• Increased rate of pets in the household.
• Improved marriage satisfaction rates.

Correct answer: An 86-year old male mayor who is revered in the community.

The passage highlights Finland's high sauna use and its relevance to population studies. While not explicitly stated, high sauna use is often associated with health benefits and longevity in Finnish culture. An 86-year-old mayor suggests a population with good health and an active elderly demographic, which aligns with potential positive outcomes from widespread cultural practices like sauna use.

Question 94: A strand of RNA that typically forms a transmembrane protein that aids potassium entrance into muscle cells has been altered to produce a different strand. The original strand goes like this: <br> GAAUAGAUGGGAAGCGCCAGAUACAGUAACAGA… The following is the modified sequence: <br> GAAUAGAUGGGAAGCGCCAGAUACAGUACCAGA…

• Absence of the protein
• Production of a similar-sized but dysfunctional protein
• Production of a smaller, likely dysfunctional protein
• Production of a larger, likely dysfunctional protein (Correct answer)
• No change

Correct answer: Production of a larger, likely dysfunctional protein

Answer Explanation: (E) <br> The change here was a single base substitution in the stop codon of this sequence (UAA) to a regular protein sequence (UAC). Remember that the start of translation is always at AUG, and remember the stop codons UAA, UGA, UAG. If this stop codon was removed, there would be continued translation down the strand, resulting in a larger protein, which would likely be dysfunctional.

Question 95: A patient has a genetic defect causing dysfunction of cilia in airway epithelial cells. Which cellular process is most likely impaired?

• Synthesis of mucus glycoproteins
• Phagocytosis of pathogens
• Mucociliary clearance of debris (Correct answer)
• Gas exchange across the epithelium

Correct answer: Mucociliary clearance of debris

Ciliary movement in airway epithelium drives mucociliary clearance, propelling mucus and trapped particles toward the throat for removal.

Question 96: According to Maslow's hierarchy of needs, which level must generally be satisfied before an individual can focus on esteem needs?

• Transcendence needs
• Cognitive needs
• Belongingness and love needs (Correct answer)
• Aesthetic needs

Correct answer: Belongingness and love needs

In Maslow's hierarchy, belongingness and love needs (social needs) fall below esteem needs and must be reasonably met first.

Question 97: In a CARS passage, the author writes: 'While critics decry the rise of social media, they fail to acknowledge its democratizing potential.' The word 'democratizing' as used here most nearly means:

• Enforcing equal time for opposing viewpoints
• Widening access to platforms for public expression (Correct answer)
• Reducing economic inequality
• Promoting political elections

Correct answer: Widening access to platforms for public expression

In the context of social media criticism, 'democratizing' refers to lowering barriers so more people can participate in public discourse.

Question 98: What is the correct order of decreasing reactivity toward electrophilic aromatic substitution (EAS)?

• Nitrobenzene > aniline > benzene
• Benzene > aniline > nitrobenzene
• Aniline > benzene > nitrobenzene (Correct answer)
• Nitrobenzene > benzene > aniline

Correct answer: Aniline > benzene > nitrobenzene

Aniline (–NH2 is a strong activator) > benzene (no substituent) > nitrobenzene (–NO2 is a strong deactivator), reflecting electron density on the ring.

Question 99: Which reagent would best convert a carboxylic acid to a primary amine via a Curtius-type rearrangement?

• NaBH4
• DPPA (diphenylphosphoryl azide) followed by heat and hydrolysis (Correct answer)
• SOCl2 then NH3
• LiAlH4

Correct answer: DPPA (diphenylphosphoryl azide) followed by heat and hydrolysis

DPPA converts carboxylic acids to acyl azides, which rearrange on heating (Curtius rearrangement) to isocyanates; hydrolysis then gives primary amines.

Question 100: In the United States, the Industrial Revolution saw a major drive toward urbanization for living areas. Which of the following is NOT a benefit to people who relocate from rural to urban regions?

• Improved utilities
• Increased transportation
• Decrease in gentrification (Correct answer)
• Job opportunities

Correct answer: Decrease in gentrification

Answer Explanation: (C) <br> Opportunities and, conversely, challenges of urbanization have not drastically change since the initial explosion in the U.S. in the early 1900s. Infrastructure is widely available in cities, which leads to benefits outlined in the first three answers. However, a process called reurbanization, which is the second wave of urbanization that follows the first decline of a city, usually targets old areas where people who do not have the resources to move out of the city get pushed out of. This leads to substantial gentrification along these borders.

Question 101: According to the James-Lange Emotion Theory __.

• emotions cause physiological reactions
• physiological changes have no influence on emotions
• physiological changes influence emotions (Correct answer)
• a person’s thoughts about physiological reactions determine emotions

Correct answer: physiological changes influence emotions

The James-Lange theory of emotion proposes that our experience of emotion is a result of our physiological responses to stimuli. It suggests that we first perceive a stimulus, then experience a physiological reaction (e.g., increased heart rate), and *then* interpret these bodily changes as a specific emotion. Therefore, physiological changes directly influence emotions.

Question 102: The rational choice theory is founded on the idea that acts are chosen based on the individual's benefit. Completeness, transitivity, and variable independence are the three essential axioms of rational theory. What kind of system is most appropriately described?

• Matriarchal
• Oligarchic
• Patriarchal
• Hierarchical (Correct answer)

Correct answer: Hierarchical

Answer Explanation: (B) <br> The key to answering this question is to know the definitions of the components of rational choice theory. Completeness in this context means that actions can be ranked according to each other. Transitivity defines the fact that if an action is considered higher rank than a second, and a third action is considered lesser than the second, that the first action can be considered higher than the third. The final component, independence, defines the fact that additional variables do not change ranking. B, C, and D all place benefit to some individuals over others that would not change depending on the individual, which is not in concordance with this theory.

Question 103: The Bill of Rights was written specifically to defend individual rights, as stated in the text. Which of the following is NOT an example of a situation for which this statute aimed to provide individual liberties?

• A protestor gathering people outside of city hall.
• A police officer requiring a warrant before searching a car for drugs.
• A national religion allowing people to practice across states. (Correct answer)
• A Jehovah’s Witness practicing their right to refuse blood donation.

Correct answer: A national religion allowing people to practice across states.

The passage explicitly states that 'the Constitution prohibited the establishment of an official religion at the national level.' The First Amendment guarantees freedom *of* religion and prevents the government from establishing a national religion. Therefore, a national religion, even one allowing practice across states, is precisely what the Bill of Rights aimed to prevent, not provide for as an individual liberty.

Question 104: A patient with damage to Wernicke's area would most likely present with:

• Inability to produce speech (Broca's aphasia)
• Loss of reading ability only
• Complete mutism
• Fluent but nonsensical speech with poor comprehension (Correct answer)

Correct answer: Fluent but nonsensical speech with poor comprehension

Wernicke's aphasia results in fluent, grammatically intact but semantically incoherent speech and impaired language comprehension.

Question 105: A patient who cannot form new long-term memories but retains memories from before their brain injury most likely has damage to which structure?

• Amygdala
• Prefrontal cortex
• Cerebellum
• Hippocampus (Correct answer)

Correct answer: Hippocampus

The hippocampus is critical for encoding new declarative (explicit) memories; damage causes anterograde amnesia while leaving older memories intact.

Question 106: During the light-dependent reactions of photosynthesis, which molecule directly donates electrons to Photosystem II?

• Ferredoxin
• Plastocyanin
• NADPH
• Water (Correct answer)

Correct answer: Water

Water is oxidized by the oxygen-evolving complex associated with PSII, providing electrons to replace those excited by light energy and releasing O2 as a byproduct.

Question 107: The World Systems Theory divides the world into three subcategories: core, periphery, and semi-periphery countries. Which of the following statements best describe countries in the semi-periphery?

• A diversified and developed economy. (Correct answer)
• Strong central government.
• Small percentage of very high class individuals.
• An economy centralized around one natural resource.

Correct answer: A diversified and developed economy.

Answer Explanation: (D) <br> This question, if encountered, would be difficult due to the fact that semi-periphery countries is actually a definition of a transition state both from core to periphery and in the opposite direction. Thus, there are no real strong defining characteristics, so elimination of answers will be needed. Strong central government more accurately defines core countries. Answers B and D describe periphery countries. Think of semi-periphery countries as those that do not have much global influence, but are not susceptible to it either. That should allow for the correct answer.

Question 108: An author writes: 'One could argue that technology isolates individuals, but this view ignores how social media sustains long-distance relationships.' The phrase 'one could argue' signals:

• The author's own position on technology
• A position the author introduces only to then rebut or qualify (Correct answer)
• A view the author will ultimately endorse
• A fact the author treats as settled

Correct answer: A position the author introduces only to then rebut or qualify

'One could argue' is a distancing phrase that typically introduces a view the author is about to counter or complicate rather than endorse.

Question 109: A passage about urban planning argues that mixed-use zoning reduces car dependency. The author then cites a study showing that residents of mixed-use neighborhoods walk more. This study functions in the argument as:

• Empirical support for the causal link between zoning and behavior (Correct answer)
• An analogy drawn from a different policy context
• A counterexample that the author must explain away
• A concession that weakens the author's main claim

Correct answer: Empirical support for the causal link between zoning and behavior

The study provides data showing behavioral change (more walking) that supports the author's claim that mixed-use zoning reduces car dependency.

Question 110: Which of the following best characterizes an institutional review board's (IRB) primary concern in research with human subjects?

• Maximizing statistical power of the study
• Minimizing research costs
• Ensuring participant welfare, informed consent, and ethical treatment (Correct answer)
• Guaranteeing publication of all research findings

Correct answer: Ensuring participant welfare, informed consent, and ethical treatment

IRBs exist to protect human research participants by reviewing studies for ethical standards, including informed consent, risk minimization, and voluntary participation.

Question 111: DNA methylation of CpG islands in a gene's promoter region typically results in:

• Histone acetylation and chromatin relaxation
• Increased gene expression due to enhanced polymerase binding
• Increased mutation rate at that locus
• Gene silencing and decreased transcription (Correct answer)

Correct answer: Gene silencing and decreased transcription

Methylation of CpG islands in promoter regions recruits methyl-CpG-binding repressor proteins and blocks transcription factor binding, leading to gene silencing.

Question 112: A missense mutation results in which of the following outcomes?

• No change in the amino acid sequence
• A premature stop codon
• A different amino acid incorporated into the protein (Correct answer)
• Deletion of an entire codon

Correct answer: A different amino acid incorporated into the protein

A missense mutation changes a single nucleotide, altering the codon so that a different amino acid is incorporated at that position in the polypeptide chain.

Question 113: The coronary sinus drains into which cardiac chamber?

• Right ventricle
• Left atrium
• Left ventricle
• Right atrium (Correct answer)

Correct answer: Right atrium

The coronary sinus collects venous blood from the myocardium and drains into the right atrium.

Question 114: What is the best way to describe Sergey's relationship with his half-brother?

• Tense
• Affectionate (Correct answer)
• Maternalistic
• Distant

Correct answer: Affectionate

While Sergey initially greets Levin with 'chilly friendliness,' he later demonstrates understanding and patience. When Levin asks his question, Sergey 'smiled and said: ‘That question we have no right to answer as yet.’' He comprehends Levin's 'simple and natural point of view,' which contrasts sharply with the professor's annoyance. This ability to gently engage and understand his brother, despite the academic setting, indicates an underlying affectionate or at least deeply respectful and understanding bond.

Question 115: The pterygoid plexus of veins drains into which vessel?

• Facial vein
• Internal jugular vein
• Maxillary vein (Correct answer)
• External jugular vein

Correct answer: Maxillary vein

The pterygoid plexus drains primarily into the maxillary vein, which joins the superficial temporal vein to form the retromandibular vein.

Question 116: A passage attributes the decline of print journalism primarily to the internet's disruption of advertising revenue. A critic argues that declining readership preceded internet adoption. This critique:

• Accepts the author's causal claim but proposes a different solution
• Introduces an irrelevant factor that the author already acknowledged
• Strengthens the author's argument by providing additional context
• Challenges the author's timeline, suggesting the cause may precede the proposed cause (Correct answer)

Correct answer: Challenges the author's timeline, suggesting the cause may precede the proposed cause

If readership fell before the internet became widespread, the internet cannot be the primary cause of print journalism's decline, undermining the author's causal sequence.

Question 117: During eukaryotic RNA processing, which modification is added to the 5' end of pre-mRNA?

• A poly-A tail (200–250 adenine nucleotides)
• An AAUAAA polyadenylation signal
• A Kozak consensus sequence
• A 7-methylguanosine (m7G) cap (Correct answer)

Correct answer: A 7-methylguanosine (m7G) cap

A 7-methylguanosine cap is co-transcriptionally added to the 5' end of pre-mRNA, protecting it from exonucleolytic degradation and facilitating ribosome recognition for translation initiation.

Question 118: A passage describes how a 19th-century novelist embedded political critique within romantic plots to avoid censorship. This strategy is best described as:

• Naturalistic writing that depicts social conditions without authorial judgment
• Formalist writing that subordinates content to aesthetic form
• Allegorical writing that encodes subversive meaning in surface-level narrative (Correct answer)
• Propagandistic writing that directly promotes a political agenda

Correct answer: Allegorical writing that encodes subversive meaning in surface-level narrative

Using romance as a surface layer to convey hidden political meaning is the defining feature of allegory, a mode where narrative elements stand for ideas beyond themselves.

Question 119: On arriving in Moscow by a morning train, Levin had put up at the house of his elder half-brother, Koznishev. After changing his clothes he went down to his brother’s study, intending to talk to him at once about the object of his visit, and to ask his advice; but his brother was not alone. With him there was a well-known professor of philosophy, who had come from Harkov expressly to clear up a difference that had arisen between them on a very important philosophical question. The professor was carrying on a hot crusade against materialists. Sergey Koznishev had been following this crusade with interest, and after reading the professor’s last article, he had written him a letter stating his objections. He accused the professor of making too great concessions to the materialists. And the professor had promptly appeared to argue the matter out. The point in discussion was the question then in vogue: Is there a line to be drawn between psychological and physiological phenomena in man? and if so, where? Sergey Ivanovitch met his brother with the smile of chilly friendliness he always had for everyone, and introducing him to the professor, went on with the conversation. A little man in spectacles, with a narrow forehead, tore himself from the discussion for an instant to greet Levin, and then went on talking without paying any further attention to him. Levin sat down to wait till the professor should go, but he soon began to get interested in the subject under discussion. Levin had come across the magazine articles about which they were disputing, and had read them, interested in them as a development of the first principles of science, familiar to him as a natural science student at the university. But he had never connected these scientific deductions as to the origin of man as an animal, as to reflex action, biology, and sociology, with those questions as to the meaning of life and death to himself, which had of late been more and more often in his mind. As he listened to his brother’s argument with the professor, he noticed that they connected these scientific questions with those spiritual problems, that at times they almost touched on the latter; but every time they were close upon what seemed to him the chief point, they promptly beat a hasty retreat, and plunged again into a sea of subtle distinctions, reservations, quotations, allusions, and appeals to authorities, and it was with difficulty that he understood what they were talking about. ‘I cannot admit it,’ said Sergey Ivanovitch, with his habitual clearness, precision of expression, and elegance of phrase. ‘I cannot in any case agree with Keiss that my whole conception of the external world has been derived from perceptions. The most fundamental idea, the idea of existence, has not been received by me through sensation; indeed, there is no special sense-organ for the transmission of such an idea.’ ‘Yes, but they—Wurt, and Knaust, and Pripasov—would answer that your consciousness of existence is derived from the conjunction of all your sensations, that that consciousness of existence is the result of your sensations. Wurt, indeed, says plainly that, assuming there are no sensations, it follows that there is no idea of existence.’ ‘I maintain the contrary,’ began Sergey Ivanovitch. But here it seemed to Levin that just as they were close upon the real point of the matter, they were again retreating, and he made up his mind to put a question to the professor. ‘According to that, if my senses are annihilated, if my body is dead, I can have no existence of any sort?’ he queried. The professor, in annoyance, and, as it were, mental suffering at the interruption, looked round at the strange inquirer, more like a bargeman than a philosopher, and turned his eyes upon Sergey Ivanovitch, as though to ask: What’s one to say to him? But Sergey Ivanovitch, who had been talking with far less heat and one-sidedness than the professor, and who had sufficient breadth of mind to answer the professor, and at the same time to comprehend the simple and natural point of view from which the question was put, smiled and said: ‘That question we have no right to answer as yet.’ ‘We have not the requisite data,’ chimed in the professor, and he went back to his argument. ‘No,’ he said; ‘I would point out the fact that if, as Pripasov directly asserts, perception is based on sensation, then we are bound to distinguish sharply between these two conceptions.’ Levin listened no more, and simply waited for the professor to go. <br> How would you describe Levin's personality?

• Unintelligent
• Arrogant
• Boisterous
• Timid (Correct answer)

Correct answer: Timid

Levin's actions throughout the passage suggest timidity. He 'sat down to wait till the professor should go' and only asks a question after some hesitation. When he does speak, the professor reacts with 'annoyance' and dismisses him as 'more like a bargeman than a philosopher,' indicating Levin is perceived as an outsider and is not assertive in this academic environment.

Question 120: A converging lens with focal length 20 cm forms a virtual image 40 cm from the lens on the same side as the object. What is the object distance?

• 40 cm
• 13.3 cm (Correct answer)
• 20 cm
• 60 cm

Correct answer: 13.3 cm

Using 1/f = 1/do + 1/di with di = −40 cm (virtual): 1/20 = 1/do − 1/40 → 1/do = 1/20 + 1/40 = 3/40, do ≈ 13.3 cm.

Question 121: Which of the following statements about diffusion and osmosis is correct?

• Diffusion and osmosis cannot occur simultaneously.
• Diffusion and osmosis will proceed in the same direction if there is only one solute.
• Diffusion and osmosis rely on the electrochemical gradient of only the compound of interest. (Correct answer)
• Diffusion and osmosis rely on the electrochemical gradient of all compounds in a cell.

Correct answer: Diffusion and osmosis rely on the electrochemical gradient of only the compound of interest.

Diffusion is the net movement of particles from an area of higher concentration to an area of lower concentration, driven by the concentration gradient of that specific substance. Osmosis is the diffusion of water across a selectively permeable membrane, driven by the water potential gradient, which is influenced by the solute concentration. Both processes are specific to the substance moving and are driven by its own electrochemical gradient, not the gradients of all other compounds.

Question 122: A community health program that provides resources to all residents of a low-income neighborhood rather than targeting specific individuals reflects which health equity principle?

• Universal precaution
• Individual risk reduction
• Health determinism
• Population-level intervention (Correct answer)

Correct answer: Population-level intervention

Population-level interventions address the social and environmental determinants of health for entire communities rather than focusing on individual-level behavior change.

Question 123: The autonomic nervous system's parasympathetic branch is characterized by which neurotransmitter at the target organ?

• Acetylcholine (Correct answer)
• Dopamine
• Epinephrine
• Norepinephrine

Correct answer: Acetylcholine

Parasympathetic postganglionic neurons release acetylcholine onto target organs, mediating 'rest-and-digest' functions.

Question 124: During pre-mRNA splicing, which sequences are removed to produce mature mRNA?

• The 5' methylguanosine cap
• Exons (expressed sequences)
• The 3' poly-A tail
• Introns (intervening sequences) (Correct answer)

Correct answer: Introns (intervening sequences)

Introns are non-coding intervening sequences excised from pre-mRNA by the spliceosome; the remaining exons are ligated together to form the mature mRNA that is translated.

Question 125: The concept of 'cognitive dissonance' predicts that when a person behaves in a way inconsistent with their beliefs, they will most likely:

• Alter their attitude to align with the behavior (Correct answer)
• Experience heightened motivation to repeat the behavior
• Change their behavior immediately
• Ignore the inconsistency entirely

Correct answer: Alter their attitude to align with the behavior

Cognitive dissonance causes psychological discomfort, which people typically reduce by changing their attitudes to match their behavior (post hoc rationalization).

Question 126: An ideal gas undergoes an isothermal compression. Which of the following remains constant?

• Pressure
• Kinetic energy of molecules
• Volume
• Temperature (Correct answer)

Correct answer: Temperature

By definition, isothermal means constant temperature; kinetic energy of molecules (∝ T) also stays constant, but 'temperature' is the direct answer.

Question 127: Which of the following structures is responsible for ribosome biogenesis in eukaryotic cells?

• Centrosome
• Nucleolus (Correct answer)
• Smooth endoplasmic reticulum
• Golgi apparatus

Correct answer: Nucleolus

The nucleolus is the site within the nucleus where rRNA genes are transcribed and ribosomal subunits are assembled before being exported to the cytoplasm.

Question 128: Which glycolytic intermediate is also a precursor for the synthesis of serine?

• Fructose-6-phosphate
• Phosphoenolpyruvate
• 3-Phosphoglycerate (Correct answer)
• Glucose-6-phosphate

Correct answer: 3-Phosphoglycerate

3-Phosphoglycerate is diverted from glycolysis to form serine via the phosphoserine pathway.

Question 129: A passage about legal philosophy argues that laws derive legitimacy from social consensus rather than from natural law or divine authority. A question asks which scenario would most challenge this view. The best answer is:

• A legislature debates a bill for several months before passing it
• International human rights agreements are ratified by most nations
• A democratic majority passes a law later found to violate individual rights (Correct answer)
• Citizens regularly follow laws even when they disagree with them

Correct answer: A democratic majority passes a law later found to violate individual rights

If a law emerges from social consensus yet violates rights, it challenges the idea that consensus alone is sufficient for legitimacy—suggesting laws may need an external standard beyond mere agreement.

Question 130: According to the James-Lange theory of emotion, emotions arise from:

• Simultaneous physiological arousal and emotional experience
• Awareness of one's own physiological responses to stimuli (Correct answer)
• Subcortical brain activation independent of conscious awareness
• Cognitive appraisal of a situation followed by physiological arousal

Correct answer: Awareness of one's own physiological responses to stimuli

The James-Lange theory holds that we experience emotion by perceiving our bodily physiological responses (e.g., 'I am afraid because I am trembling').

Question 131: Which immunoglobulin class is the first to be produced during a primary immune response?

• IgE
• IgM (Correct answer)
• IgA
• IgG

Correct answer: IgM

IgM is the first antibody produced during a primary immune response due to its pentameric structure and early B cell expression before class switching occurs.

Question 132: Which of the following professor character developments do you think is most likely to happen as the tale progresses?

• He is a world-renowned neurosurgeon.
• He is a devout Christian.
• He believes non-university graduates to be inferior. (Correct answer)
• He is a volunteer at a homeless shelter.

Correct answer: He believes non-university graduates to be inferior.

The professor's reaction to Levin's question is highly dismissive and condescending. He looks at Levin 'in annoyance, and, as it were, mental suffering at the interruption,' and mentally labels him 'more like a bargeman than a philosopher.' This strong negative judgment of someone outside his academic sphere suggests an elitist attitude and a belief in the inferiority of non-university graduates.

Question 133: Which metabolic pathway is uniquely active in the absorptive state to convert excess glucose to fatty acids?

• Beta-oxidation
• De novo lipogenesis (Correct answer)
• Gluconeogenesis
• Glycogenolysis

Correct answer: De novo lipogenesis

De novo lipogenesis converts excess acetyl-CoA (from glucose catabolism) into fatty acids during the absorptive state when insulin is high.

Question 134: While investigating mining samples off the coast of Columbia, a scientist discovers an element that has never been detected by humans. The molecule possesses an electronegativity similar to iron, according to extensive testing (Fe). What would the following values be regarding magnesium if the characteristics of this element were found to be consistent with iron? Make use of the periodic table as a guide.

• Increased electronegativity, decreased ionization energy, decreased atomic radius
• Increased electronegativity, increased ionization energy, decreased atomic radius (Correct answer)
• Decreased electronegativity, decreased ionization energy, decreased atomic radius
• Decreased electronegativity, increased ionization energy, increased atomic radius

Correct answer: Increased electronegativity, increased ionization energy, decreased atomic radius

Periodic trends indicate that as you move across a period from left to right and up a group, electronegativity and ionization energy generally increase, while atomic radius decreases. Magnesium (Mg) is in Group 2, Period 3. Iron (Fe) is a transition metal, located to the right and below Mg on the periodic table. Therefore, an element with characteristics similar to iron would have a higher electronegativity, higher ionization energy, and a smaller atomic radius compared to magnesium.

Question 135: Which statement correctly describes the function of telomerase?

• It adds repetitive DNA sequences to chromosome ends (Correct answer)
• It removes RNA primers from Okazaki fragments
• It ligates Okazaki fragments together
• It unwinds the double helix ahead of the replication fork

Correct answer: It adds repetitive DNA sequences to chromosome ends

Telomerase is a reverse transcriptase that uses its internal RNA template to add TTAGGG repeat sequences to the 3' ends of chromosomes, counteracting shortening.

Question 136: The blood-brain barrier is primarily formed by:

• Microglia patrolling capillary walls
• Myelin sheaths surrounding capillaries
• Oligodendrocytes wrapping around blood vessels
• Tight junctions between cerebral endothelial cells, supported by astrocytes (Correct answer)

Correct answer: Tight junctions between cerebral endothelial cells, supported by astrocytes

The blood-brain barrier consists of tight junctions between endothelial cells lining brain capillaries, with astrocytic endfeet providing additional support and regulation.

Question 137: Which brain structure is most critically involved in the formation of new declarative memories?

• Cerebellum
• Basal ganglia
• Hippocampus (Correct answer)
• Amygdala

Correct answer: Hippocampus

The hippocampus is essential for consolidating new declarative (explicit) memories, including episodic and semantic information.

Question 138: During DNA replication, around for per 100,000/1 million copies, an error is written into the leading strand. Several mechanisms are used to proofread this DNA. Which repair process is most likely at action if a mistake is discovered and the erroneous base is deleted immediately after the RNA primer is removed?

• Endonuclease repair
• Mismatch repair mechanism
• DNA polymerase III
• DNA polymerase I (Correct answer)

Correct answer: DNA polymerase I

Answer Explanation: (C) <br> DNA repair is a crucial biological mechanism to ensure proper coding. The first line of defense against an improperly coded base is 3’-5’ activity by DNA polymerase III, which both synthesizes DNA and checks for mistakes in the reverse direction. Followed by this, DNA polymerase I, while removing the RNA primer, checks for mistakes in the 5’-3’ direction. Finally, mismatch repair proteins check synthesized DNA strands for mistakes. Endonuclease activity describes going inside a DNA strand to repair a mistake, whereas the mistake described above was corrected by excising a single base before ligation.

Question 139: Which structure forms the posterior boundary of the epiploic foramen (foramen of Winslow)?

• Common bile duct
• Portal vein
• Inferior vena cava (Correct answer)
• Hepatoduodenal ligament

Correct answer: Inferior vena cava

The inferior vena cava forms the posterior boundary of the epiploic foramen, allowing access to the lesser sac.

Question 140: Which statement best describes the inductive effect of a fluorine substituent on benzoic acid?

• It has no effect on acidity
• It donates electrons inductively, raising pKa
• It withdraws electrons inductively, lowering pKa (Correct answer)
• It donates electrons via resonance, raising pKa

Correct answer: It withdraws electrons inductively, lowering pKa

Fluorine is highly electronegative and withdraws electron density inductively, stabilizing the carboxylate anion and lowering the pKa (increasing acidity).

Question 141: The fovea centralis of the retina is specialized for high-acuity color vision and is densely packed with which photoreceptors?

• Rods only
• Melanopsin-containing ganglion cells
• Cones only (Correct answer)
• Equal rods and cones

Correct answer: Cones only

The fovea centralis contains only cones (no rods, no blood vessels) to maximize visual acuity and color discrimination in bright light.

Question 142: A researcher studying attachment finds that infants who explore freely when their caregiver is present but become distressed when left alone and are easily soothed upon reunion are classified as which attachment type?

• Avoidant attachment
• Secure attachment (Correct answer)
• Disorganized attachment
• Anxious-ambivalent attachment

Correct answer: Secure attachment

Secure attachment is characterized by using the caregiver as a safe base for exploration, distress upon separation, and quick comfort upon reunion.

Question 143: According to Hardy-Weinberg equilibrium, which condition must be met for a population to remain in equilibrium?

• Mating is nonrandom within the population
• Natural selection is actively occurring
• Population size is very small
• Allele and genotype frequencies remain constant across generations (Correct answer)

Correct answer: Allele and genotype frequencies remain constant across generations

Hardy-Weinberg equilibrium describes a state where allele and genotype frequencies remain constant generation after generation in the absence of evolutionary forces.

Question 144: George Herbert Mead's concept of the 'generalized other' refers to:

• A specific significant person whose opinions shape one's self-concept
• The collective identity formed through shared cultural practices
• The imagined audience one considers when making decisions
• The internalized sense of the expectations and attitudes of society as a whole (Correct answer)

Correct answer: The internalized sense of the expectations and attitudes of society as a whole

The generalized other represents an individual's awareness of societal norms and expectations, which are internalized through social interaction during development.

Question 145: The appendix most commonly arises from the cecum at which taenia coli convergence point?

• Taenia omentalis
• Taenia libera
• Convergence of all three taeniae coli (Correct answer)
• Taenia mesocolica

Correct answer: Convergence of all three taeniae coli

The three taeniae coli converge at the base of the appendix, making this anatomical landmark useful for locating the appendix surgically.

Question 146: During translation, which RNA molecule carries specific amino acids to the ribosome?

• tRNA (transfer RNA) (Correct answer)
• snRNA (small nuclear RNA)
• mRNA (messenger RNA)
• rRNA (ribosomal RNA)

Correct answer: tRNA (transfer RNA)

Transfer RNA (tRNA) molecules serve as adaptors, each carrying a specific amino acid and containing an anticodon that base-pairs with the complementary mRNA codon at the ribosome.

Question 147: During the fed state, glucokinase activity in hepatocytes increases because:

• High glucose concentrations overcome its low affinity for glucose
• Glucagon stimulates its gene transcription
• It is activated by insulin-mediated phosphorylation
• It is released from a nuclear inhibitor protein (Correct answer)

Correct answer: It is released from a nuclear inhibitor protein

Glucokinase is sequestered in the nucleus by a regulatory protein at low glucose; when glucose rises, it dissociates and enters the cytoplasm to phosphorylate glucose.

Question 148: During a timed CARS section, a student reads a passage but finds the main argument unclear after the first read-through. The most effective strategy is to:

• Skip all questions for that passage and return at the end of the section
• Answer all questions based on general knowledge of the topic
• Re-read the entire passage from the beginning before attempting any questions
• Use the questions themselves to identify what aspects of the passage are most important, then re-read targeted sections (Correct answer)

Correct answer: Use the questions themselves to identify what aspects of the passage are most important, then re-read targeted sections

CARS questions highlight what the test-makers consider most important; using them to guide targeted re-reading is more efficient than a full second read under time pressure.

Question 149: A rare genetic disease with X-linked recessive transmission is discovered in a newborn's genetic test. Which of the following claims about this disorder's pedigree is most likely correct?

• All descendants on the maternal side will have the disorder.
• Females will be approximately twice as affected as males in this family.
• There will be equal distribution of males and females affected.
• All daughters of an affected male will be affected. (Correct answer)

Correct answer: All daughters of an affected male will be affected.

For an X-linked recessive disorder, an affected male (X^rY) passes his X chromosome, which carries the recessive allele (X^r), to all of his daughters. Therefore, all daughters will inherit this recessive allele. While they may not express the phenotype if they are heterozygous carriers (X^rX^N), they are genetically 'affected' in the sense of carrying the disease allele.

Question 150: A CARS passage describes a philosopher who claims that free will is incompatible with determinism. Which of the following, if true, would most directly strengthen this philosopher's position?

• Many people report subjectively feeling that they make free choices
• Determinism is accepted by most contemporary physicists
• Neuroscience shows that brain activity preceding a decision occurs before conscious awareness of the choice (Correct answer)
• Ancient philosophers also debated the nature of free will

Correct answer: Neuroscience shows that brain activity preceding a decision occurs before conscious awareness of the choice

If unconscious brain activity precedes and drives decisions, conscious choice appears illusory, directly supporting the claim that determinism undermines free will.

Question 151: A capacitor with capacitance 4 μF is connected to a 12 V battery. What charge is stored on the capacitor?

• 3 μC
• 48 μC (Correct answer)
• 0.33 μC
• 16 μC

Correct answer: 48 μC

Q = CV = 4 × 10⁻⁶ × 12 = 48 × 10⁻⁶ C = 48 μC.

Question 152: On the third day of an evolution symposium, two scientists take the stage to debate their beliefs. Each is a passionate follower of their respective philosophy. According to the first scientist, organisms evolved by increasing the number of organs that were employed the most at the time. They'd then pass them down to future generations. The second scientist, on the other hand, believed that each organism's advantages were absent for a long time, then appeared at random, and when they were helpful, that organism would swiftly populate the population over a short period of time, according to evolution. Which of the following statements would support the argument of the second scientist?

• A study that showed a consistent amount of time between the emergence of each new species.
• A study that shows that bodybuilders who train more have larger children.
• A study that showed a species who were more successful due to the things they learned over their lifetime that they passed on to their children.
• A taxonomy study that shows long periods of stagnant growth followed by short burst of massive evolution. (Correct answer)

Correct answer: A taxonomy study that shows long periods of stagnant growth followed by short burst of massive evolution.

Scientist 2's view aligns with the theory of punctuated equilibrium, which proposes that evolution is characterized by long periods of little or no change (stasis) interrupted by brief periods of rapid speciation and evolutionary change. Therefore, a taxonomy study showing long periods of stagnant growth followed by short bursts of massive evolution would directly support the argument of the second scientist.

Question 153: Which of the following scenarios best exemplifies 'role conflict'?

• A nurse who must adapt their communication style for different patients
• A surgeon who performs procedures she finds ethically questionable because hospital policy requires it
• A medical resident who must choose between staying to care for a critical patient or attending their child's school play (Correct answer)
• A physician who transitions from clinical practice to hospital administration

Correct answer: A medical resident who must choose between staying to care for a critical patient or attending their child's school play

Role conflict occurs when the demands of two or more social roles a person holds are incompatible, requiring a choice between competing obligations.

Question 154: A patient cannot recognize faces even though visual acuity is intact. This condition is called:

• Agnosia for objects
• Achromatopsia
• Prosopagnosia (Correct answer)
• Hemianopia

Correct answer: Prosopagnosia

Prosopagnosia is the selective inability to recognize familiar faces, typically associated with damage to the fusiform face area.

Question 155: During meiosis I, homologous chromosomes separate. This division reduces the chromosome number from:

• Haploid (n) to haploid (n)
• Tetraploid (4n) to diploid (2n)
• Haploid (n) to diploid (2n)
• Diploid (2n) to haploid (n) (Correct answer)

Correct answer: Diploid (2n) to haploid (n)

Meiosis I is the reductional division where homologous chromosome pairs separate, halving the chromosome number from diploid (2n) to haploid (n) in each resulting cell.

Question 156: What is the Michaelis constant (Km) a measure of?

• Maximum reaction velocity
• Product inhibition strength
• Substrate affinity for the enzyme (Correct answer)
• Enzyme concentration

Correct answer: Substrate affinity for the enzyme

Km is the substrate concentration at which reaction velocity is half of Vmax; a lower Km indicates higher affinity of the enzyme for its substrate.

Question 157: Which of the following is true about the electric field inside a conductor in electrostatic equilibrium?

• It points radially outward
• It is equal to the surface charge density divided by ε₀
• It is zero (Correct answer)
• It equals kQ/r²

Correct answer: It is zero

In electrostatic equilibrium, charges redistribute to the surface, resulting in zero electric field inside the conductor.

Question 158: In the photoelectric effect, increasing the intensity of incident light (without changing frequency) will:

• Have no effect because intensity doesn't affect the photoelectric effect
• Increase the kinetic energy of emitted electrons
• Increase the stopping potential
• Increase the number of emitted electrons per second (Correct answer)

Correct answer: Increase the number of emitted electrons per second

Higher intensity means more photons per second, which ejects more electrons per second, but does not change each electron's kinetic energy.

Question 159: A young child is taken to a psychologist to have their home circumstances evaluated. The mother is on one side and the psychologist is on the other while the child is placed in the middle of the floor. The mother then departs for a brief while before returning. Which of the following would be a red flag during this assessment?

• Avoiding the mother upon return. (Correct answer)
• Exploring the room before the mother leaves.
• Decreased exploration when the mother is out of the room.
• Crying and returning to the mother upon return.

Correct answer: Avoiding the mother upon return.

This scenario describes the 'Strange Situation' experiment, designed to assess attachment styles. Avoiding the mother upon her return is a key indicator of an insecure-avoidant attachment style. In this pattern, the child shows little distress when the mother leaves and actively avoids or ignores her upon her return, which is considered a red flag for healthy attachment development.

Question 160: An author presents evidence that bilingual children outperform monolingual children on certain cognitive tasks, then concludes that 'all children should be taught a second language.' This reasoning is flawed because:

• The study did not account for socioeconomic differences between groups
• The author ignores that correlation between bilingualism and performance does not prove bilingualism causes improved cognition
• The conclusion overgeneralizes from a specific cognitive benefit to a broad educational policy recommendation (Correct answer)
• The sample size of bilingual children studied was too small

Correct answer: The conclusion overgeneralizes from a specific cognitive benefit to a broad educational policy recommendation

Even if bilingualism correlates with cognitive benefits, the leap to a universal educational mandate is an overgeneralization that the evidence does not fully support.

Question 161: Which of the following correctly describes the Hardy-Weinberg principle?

• Genetic drift is negligible only in small populations
• Allele frequencies change predictably with each generation
• Natural selection always drives populations toward Hardy-Weinberg equilibrium
• In a large random-mating population without evolutionary forces, allele frequencies remain constant (Correct answer)

Correct answer: In a large random-mating population without evolutionary forces, allele frequencies remain constant

Hardy-Weinberg states that in an idealized population (large, random mating, no mutation/migration/selection/drift), allele and genotype frequencies remain constant across generations.

Question 162: The inguinal ligament is formed by the lower edge of which abdominal muscle's aponeurosis?

• External oblique (Correct answer)
• Transversus abdominis
• Rectus abdominis
• Internal oblique

Correct answer: External oblique

The inguinal ligament is the folded-under lower edge of the external oblique aponeurosis, running from the ASIS to the pubic tubercle.

Question 163: Which fontanelle is the last to close and is located at the junction of the sagittal and coronal sutures?

• Sphenoidal fontanelle
• Anterior (frontal) fontanelle (Correct answer)
• Mastoid fontanelle
• Posterior (occipital) fontanelle

Correct answer: Anterior (frontal) fontanelle

The anterior fontanelle, located at the bregma (junction of sagittal and coronal sutures), is the largest and last to close, typically around 18-24 months.

Question 164: Which of the following is an example of negative reinforcement?

• Getting a speeding ticket to reduce fast driving
• Taking ibuprofen to relieve a headache, increasing the likelihood of future ibuprofen use (Correct answer)
• Being praised for completing homework
• Receiving a trophy for winning a competition

Correct answer: Taking ibuprofen to relieve a headache, increasing the likelihood of future ibuprofen use

Negative reinforcement involves removing an aversive stimulus (pain) following a behavior (taking ibuprofen), which increases the probability of that behavior recurring.

Question 165: Which neurotransmitter is primarily depleted in Parkinson's disease, leading to motor deficits?

• Acetylcholine
• GABA
• Serotonin
• Dopamine (Correct answer)

Correct answer: Dopamine

Parkinson's disease results from loss of dopaminergic neurons in the substantia nigra, disrupting the motor control circuit.

Question 166: Which of the following best explains why the pH of a strong acid solution with concentration 1×10⁻⁸ M is NOT 8?

• Strong acids only partially dissociate at very low concentrations
• The autoionization of water contributes significantly to [H⁺] at very low acid concentrations (Correct answer)
• The activity coefficient of H⁺ changes at low concentration
• Strong acids form ion pairs at very low concentrations

Correct answer: The autoionization of water contributes significantly to [H⁺] at very low acid concentrations

At 10⁻⁸ M, the H⁺ from water autoionization (10⁻⁷ M) dominates, so the actual [H⁺] ≈ 10⁻⁷ M and pH ≈ 7, not 8.

Question 167: Vygotsky's sociocultural development theory tries to explain the relationship between the mental functions that children are born with and how they develop into adulthood. The zone of proximal development is a key component of this. Which of the following statements best defines a person in the proximal development zone?

• A baseball player hits baseballs from a tee in order to build muscle memory.
• A concert flute player falls short of finishing a piece that has a very complex ending without mistakes
• A high diver takes instruction from her coach to improve her form on a specific move. (Correct answer)
• A high school English student submits a paper for review by his professor.

Correct answer: A high diver takes instruction from her coach to improve her form on a specific move.

Vygotsky's Zone of Proximal Development (ZPD) refers to the gap between what a learner can achieve independently and what they can achieve with guidance from a more knowledgeable other (MKO). The high diver receiving instruction from her coach to improve a specific move perfectly illustrates this, as she is learning a skill just beyond her current independent ability with expert assistance.

Question 168: The author's position on "moneyed and proprietied interests" (paragraph 4) is best summarized as:

• ambivalent
• negative. (Correct answer)
• indifferent.

Correct answer: negative.

The author consistently portrays 'moneyed and propertied interests' negatively. They are described as 'unnerved' by popular uprisings and 'instrumental' in creating a 'more robust central government' that ultimately serves a 'nouveau aristocracy of corporate 'persons' and the rapacious class of executives.' This language clearly conveys a critical and disapproving stance towards their influence and actions.

Question 169: The concept of 'social mobility' refers to:

• The spread of social norms through media and cultural exchange
• Geographic migration between different social environments
• The formation of new social classes through industrialization
• The movement of individuals or groups between different levels of the social hierarchy (Correct answer)

Correct answer: The movement of individuals or groups between different levels of the social hierarchy

Social mobility describes upward or downward movement within a social stratification system, and can be intergenerational or intragenerational.

Question 170: One of the clauses of the first amendment that has come to be considered as a part of the law is that no one can yell "fire!" In a congested space. Why would they put this restriction in place?

• It endangers children.
• It allows the government to hold too much power.
• It infringes on the safety of others. (Correct answer)
• It would be unlawful seizure of property.

Correct answer: It infringes on the safety of others.

While the First Amendment protects freedom of speech, this right is not absolute. Yelling 'fire!' in a crowded space when there is no actual fire is a classic example of speech that is restricted because it directly incites panic, creates disorder, and poses a significant risk to public safety, potentially leading to injuries or even fatalities. The restriction prioritizes the collective safety of individuals over an individual's right to reckless speech.

Question 171: According to signal detection theory, a radiologist who sets a very liberal criterion to catch all cancers, even at the cost of many false positives, is said to have:

• A lenient criterion (low beta) producing many false alarms (Correct answer)
• High sensitivity and high d-prime
• High specificity and low sensitivity
• A low threshold (beta) and many misses

Correct answer: A lenient criterion (low beta) producing many false alarms

A lenient (low beta) criterion means the observer says 'yes' (signal present) even when uncertain, resulting in many hits but also many false alarms.

Question 172: A passage presents a sociologist's view that crime rates reflect structural inequality rather than individual moral failing. The author's rhetorical goal in emphasizing 'structural' is most likely to:

• Argue that law enforcement budgets should be reduced
• Claim that poverty always leads to criminal behavior
• Exonerate individuals from all personal responsibility for criminal acts
• Shift analytical focus from individual behavior to systemic social conditions (Correct answer)

Correct answer: Shift analytical focus from individual behavior to systemic social conditions

Emphasizing structural causes redirects explanation toward social systems rather than personal character, which is the sociologist's analytical move.

Question 173: The concept of 'intersectionality' in sociology was developed to explain:

• How cultural and economic globalization intersect to produce inequality
• How overlapping social identities such as race, gender, and class create compounded experiences of privilege or oppression (Correct answer)
• The intersection of formal and informal social norms in institutional settings
• The point at which social mobility between classes becomes impossible

Correct answer: How overlapping social identities such as race, gender, and class create compounded experiences of privilege or oppression

Intersectionality, developed by Kimberlé Crenshaw, describes how multiple social identities interact to shape unique experiences of discrimination or advantage.

Question 174: An author states: 'The Romantic poets were reacting against the rationalism of the Enlightenment.' This claim implies that Enlightenment rationalism was:

• Irrelevant to understanding nineteenth-century poetry
• Primarily a literary rather than philosophical movement
• Compatible with Romantic values of emotional expression
• A dominant cultural force that Romantic poets found inadequate or oppressive (Correct answer)

Correct answer: A dominant cultural force that Romantic poets found inadequate or oppressive

To 'react against' something implies it was sufficiently powerful and present that it provoked a deliberate counter-movement.

Question 175: Which of the following paragraphs is most likely to follow this snippet in the article?

• A study on rats exposed to high levels of heat.
• A paragraph on increased heart attacks in Eskimo populations.
• A recap of Finland’s water polo team excellence.
• A paragraph on a protein that facilitates intracellular function in response to heat.

The preceding snippet introduces research on high sauna use in Finland and its relevance to population studies. A logical next step in such an article would be to explore the physiological mechanisms by which heat exposure, like that from saunas, impacts the human body. Discussing a protein that facilitates intracellular function in response to heat directly addresses the biological underpinnings of the observed effects.

Question 176: Which factor is most important when evaluating the quality of scientific research for MCAT?

• Methodology, sample size, and peer review status (Correct answer)
• Number of references cited
• Reputation of the authors
• Length of the study report

Correct answer: Methodology, sample size, and peer review status

Research quality is best evaluated by examining the methodology, adequacy of sample size, and whether the study has undergone peer review.

Question 177: 1. The Will to Truth, which is to tempt us to many a hazardous enterprise, the famous Truthfulness of which all philosophers have hitherto spoken with respect, what questions has this Will to Truth not laid before us! What strange, perplexing, questionable questions! It is already a long story, yet it seems as if it were hardly commenced. Is it any wonder if we, at last, grow distrustful, lose patience, and turn impatiently away? That this Sphinx teaches us at last to ask questions ourselves? WHO is it really that puts questions to us here? WHAT really is this "Will to Truth" in us? In fact, we made a long halt at the question as to the origin of this Will—until at last, we came to an absolute standstill before a yet more fundamental question. We inquired about the VALUE of this Will. Granted that we want the truth: WHY NOT RATHER untruth? And uncertainty? Even ignorance? The problem of the value of truth presented itself before us—or was it we who presented ourselves before the problem? Which of us is Oedipus here? Which the Sphinx? It would seem to be a rendezvous of questions and notes of interrogation. And could it be believed that it, at last, seems to us as if the problem had never been propounded before as if we were the first to discern it, get a sight of it, and RISK RAISING it? For there is risk in raising it, perhaps there is no greater risk. <br> 2. "HOW COULD anything originate out of its opposite? For example, truth out of error? or the Will to Truth out of the will to deception? or the generous deed out of selfishness? or the pure sun-bright vision of the wise man out of covetousness? Such genesis is impossible; whoever dreams of it is a fool, nay, worse than a fool; things of the highest value must have a different origin, an origin of THEIR own—in this transitory, seductive, illusory, paltry world, in this turmoil of delusion and cupidity, they cannot have their source. But rather in the lap of Being, in the in transitory, in the concealed God, in the 'Thing-in-itself—THERE must be their source, and nowhere else!"—This mode of reasoning discloses the typical prejudice by which metaphysicians of all times can be recognized, this mode of valuation is at the back of all their logical procedure; through this "belief" of theirs, they exert themselves for their "knowledge," for something that is in the end solemnly christened "the Truth." The fundamental belief of metaphysicians is THE BELIEF IN ANTITHESES OF VALUES. It never occurred even to the wariest of them to doubt here on the very threshold (where doubt, however, was most necessary); though they had made a solemn vow, "DE OMNIBUS DUBITANDUM." For it may be doubted, firstly, whether antitheses exist at all; and secondly, whether the popular valuations and antitheses of value upon which metaphysicians have set their seal are not perhaps merely superficial estimates, merely provisional perspectives, besides being probably made from some corner, perhaps from below—"frog perspectives," as it were, to borrow an expression current among painters. In spite of all the value which may belong to the true, the positive, and the unselfish, it might be possible that a higher and more fundamental value for life generally should be assigned to pretense, to the will to delusion, to selfishness, and cupidity. It might even be possible that WHAT constitutes the value of those good and respected things, consists precisely in their being insidiously related, knotted, and crocheted to these evil and apparently opposed things—perhaps even in being essentially identical with them. Perhaps! But who wishes to concern himself with such dangerous "Perhapses"! For that investigation, one must await the advent of a new order of philosophers, such as will have other tastes and inclinations, the reverse of those hitherto prevalent—philosophers of the dangerous "Perhaps" in every sense of the term. <br> And to speak in all seriousness, I see such new philosophers beginning to appear. <br> Which of the following definitions of Nietzsche's Will to Truth is the most accurate?

• A subset of our ego that acts towards what is right.
• Our desire for love.
• An intrinsic desire to know the truth. (Correct answer)
• Moral drive to act toward what is good.

Correct answer: An intrinsic desire to know the truth.

The passage introduces 'The Will to Truth' as something that 'tempt[s] us to many a hazardous enterprise' and prompts the question, 'WHAT really is this 'Will to Truth' in us?'. This framing suggests an inherent, internal drive or impulse within humans to seek and value truth. It's an intrinsic desire that the author then proceeds to question the value of.

Question 178: In the lac operon, the CAP-cAMP complex acts as a:

• Negative regulator that represses transcription when glucose is present
• Positive regulator that enhances transcription when glucose is absent (Correct answer)
• Competitive inhibitor of the lac repressor
• Post-translational modifier of beta-galactosidase

Correct answer: Positive regulator that enhances transcription when glucose is absent

When glucose is low, cAMP rises and binds CAP (catabolite activator protein), and the complex binds the lac promoter to enhance RNA polymerase binding and increase transcription.

Question 179: When answering a CARS 'Which of the following best describes the organization of the passage?' question, the most reliable approach is to:

• Select the most detailed answer choice, as it is most likely to be accurate
• Map the logical progression of the argument paragraph by paragraph, then match it to an answer choice (Correct answer)
• Choose the answer that mentions the most topics covered in the passage
• Identify the subject matter and select the answer that best describes it

Correct answer: Map the logical progression of the argument paragraph by paragraph, then match it to an answer choice

Structure questions require tracking how the argument unfolds logically across paragraphs, not just identifying topics or selecting the most detailed option.

Question 180: Which type of immunity involves the transfer of pre-formed antibodies from one individual to another?

• Active artificial immunity
• Active natural immunity
• Innate immunity
• Passive immunity (Correct answer)

Correct answer: Passive immunity

Passive immunity involves receiving pre-formed antibodies (e.g., maternal IgG across placenta or immune serum injection) without the recipient mounting an immune response.

Question 181: The Thomas Theorem states that:

• Inequality is reproduced through cultural capital and education
• Social deviance is defined by those in power
• Social structures constrain individual behavior regardless of personal beliefs
• If people define situations as real, they are real in their consequences (Correct answer)

Correct answer: If people define situations as real, they are real in their consequences

The Thomas Theorem holds that subjective perceptions of reality shape behavior and outcomes, even when those perceptions may be objectively incorrect.

Question 182: A passage traces how 'progress' changed meaning from a religious concept (divine plan) to a secular concept (scientific advancement) during the Enlightenment. The author's primary purpose is most likely to:

• Show how a key concept's meaning shifts across historical and intellectual contexts (Correct answer)
• Prove that scientific advancement is the only valid form of progress
• Demonstrate that the Enlightenment rejected all religious ideas
• Argue that religious notions of progress are superior to secular ones

Correct answer: Show how a key concept's meaning shifts across historical and intellectual contexts

Tracing semantic shifts over historical periods is a classic humanities method for showing how ideas are culturally and historically constructed.

Question 183: What product forms when an alkene reacts with ozone (O3) followed by a reductive workup (Zn, H2O)?

• Diol
• Carboxylic acid
• Two carbonyl compounds (aldehydes/ketones) (Correct answer)
• Epoxide

Correct answer: Two carbonyl compounds (aldehydes/ketones)

Ozonolysis with reductive workup cleaves the double bond to give two carbonyl compounds; aldehydes if the carbon was =CH2, ketones if disubstituted.

Question 184: A CARS passage presents an argument that ends with: 'For these reasons, the conclusion seems inescapable.' The phrase 'seems inescapable' is best interpreted as:

• A confident assertion that no reasonable person could disagree
• A sign that the author is uncertain about the argument's validity
• An invitation for the reader to reach their own independent conclusion
• A hedged claim that the author believes the argument is strong but implicitly acknowledges possible objections (Correct answer)

Correct answer: A hedged claim that the author believes the argument is strong but implicitly acknowledges possible objections

'Seems' is a hedging word that qualifies the claim, signaling the author finds the conclusion very compelling while leaving slight room for alternative views.

Question 185: A young man working with a therapist to become more productive is sharing many of his ambitions as he grew up, as well as how he believes they have affected him. The therapist believes the young man's development is trapped in a stage that is reflected in his failure to maintain his residence clean, based on his discernment. What stage of psychosexual development would this young man be fixated on, according to Freud's theory?

• Genital
• Latent
• Phallic
• Anal (Correct answer)
• Oral

Correct answer: Anal

According to Freud's psychosexual stages, the anal stage (ages 1-3) focuses on bowel and bladder control. Fixation at this stage can lead to personality traits related to control, orderliness, or messiness. A failure to maintain a clean residence, as described, aligns with 'anal-expulsive' traits, indicating a fixation on this stage where the individual might be messy or rebellious.

Question 186: A high school science teacher pours pure nitrogen into a 1 liter bottle and closes the lid. The room temperature is 25°C and the pressure is 1.70 atm. If all other factors remain constant, which two variables will both increase the system's pressure?

• Increasing temperature, increasing volume
• Increasing temperature, increasing moles of gas (Correct answer)
• Decreasing volume, decreasing temperature
• Decreasing moles of gas, increasing volume

Correct answer: Increasing temperature, increasing moles of gas

According to the ideal gas law (PV=nRT), pressure (P) is directly proportional to temperature (T) and the number of moles of gas (n), assuming volume (V) is constant. Therefore, increasing the temperature of the gas and increasing the number of moles of gas within the fixed volume will both independently lead to an increase in the system's pressure.

Question 187: Which memory category would explicit memory fall into?

• long-term memory (Correct answer)
• sensory memory
• procedural memory
• short-term memory

Correct answer: long-term memory

Explicit memory, also known as declarative memory, refers to memories that are consciously recalled, such as facts, events, and concepts. This type of memory is a component of long-term memory, which has a vast capacity and can store information for extended periods, ranging from minutes to a lifetime.

Question 188: What is Levin's most likely profession, based on the passage?

• Farmer (Correct answer)
• Professor
• Philosopher
• Businessman

Correct answer: Farmer

When Levin asks a question, the professor looks at him 'more like a bargeman than a philosopher.' This comparison suggests Levin is seen as a working-class individual, someone engaged in manual labor rather than intellectual pursuits. While 'bargeman' isn't 'farmer,' it strongly implies a rural, non-academic background. Historically, and within the context of Tolstoy's *Anna Karenina* (from which this passage is taken), Levin is indeed a landowner deeply involved in farming and rural life, which aligns with this inference.

Question 189: Which of the following describes Le Chatelier's principle?

• The equilibrium constant changes when temperature is altered
• Catalysts shift the equilibrium position toward products
• A system at equilibrium will shift to counteract any imposed change in conditions (Correct answer)
• The rate of the forward reaction always equals the rate of the reverse reaction

Correct answer: A system at equilibrium will shift to counteract any imposed change in conditions

Le Chatelier's principle states that a system in equilibrium will respond to stress (changes in concentration, pressure, or temperature) by shifting to partially counteract the disturbance.

Question 190: Which of the following compounds can pass through the descending loop of Henle of the nephron of the kidney?

• H2O (Correct answer)
• Cl-
• K+
• Na+

Correct answer: H2O

The descending loop of Henle is highly permeable to water but relatively impermeable to solutes like Na+, Cl-, and K+. As the filtrate moves down this segment, water passively exits the tubule into the hypertonic medullary interstitium, concentrating the filtrate. This selective permeability is crucial for the kidney's ability to concentrate urine.

Question 191: The hepatopancreatic ampulla (of Vater) opens into which part of the duodenum?

• Fourth part (ascending)
• Second part (descending) (Correct answer)
• Third part (horizontal)
• First part (superior)

Correct answer: Second part (descending)

The ampulla of Vater opens on the major duodenal papilla in the second (descending) part of the duodenum.

Question 192: The femoral triangle is bounded superiorly by the inguinal ligament, medially by the adductor longus, and laterally by which muscle?

• Sartorius (Correct answer)
• Iliopsoas
• Pectineus
• Rectus femoris

Correct answer: Sartorius

The lateral border of the femoral triangle is formed by the medial border of the sartorius muscle.

Question 193: The diathesis-stress model of mental illness proposes that:

• Stress alone causes all mental disorders
• Psychological disorders are purely learned behaviors
• A biological predisposition combined with environmental stressors leads to mental illness (Correct answer)
• Genetic factors fully determine psychological disorders

Correct answer: A biological predisposition combined with environmental stressors leads to mental illness

The diathesis-stress model posits that a genetic or biological vulnerability (diathesis) interacts with environmental stressors to produce psychological disorders.

Question 194: An atom has the electron configuration [Ar] 3d⁵ 4s¹. Which element is this?

• Manganese (Mn)
• Iron (Fe)
• Vanadium (V)
• Chromium (Cr) (Correct answer)

Correct answer: Chromium (Cr)

Chromium (Z=24) has the anomalous configuration [Ar] 3d⁵ 4s¹ due to the extra stability of a half-filled d subshell.

Question 195: A cell in G2 phase is treated with a drug that prevents microtubule polymerization. At which checkpoint will cell cycle arrest most likely occur?

• G1/S checkpoint
• G2/M checkpoint (Correct answer)
• Spindle assembly checkpoint
• Intra-S checkpoint

Correct answer: G2/M checkpoint

The G2/M checkpoint monitors whether DNA replication is complete and cellular machinery (including microtubules for the spindle) is ready before mitosis begins.

Question 196: Which defense mechanism involves attributing one's own unacceptable thoughts or feelings to another person?

• Projection (Correct answer)
• Sublimation
• Reaction formation
• Displacement

Correct answer: Projection

Projection is a Freudian defense mechanism in which a person unconsciously attributes their own unwanted impulses or feelings to someone else.

Question 197: Which of the following best explains why carboxylic acids have higher boiling points than alcohols of similar molecular weight?

• Carboxylic acids form stable dimers via two hydrogen bonds (Correct answer)
• Carboxylic acids undergo ionic bonding
• Carboxylic acids have lower molecular weight
• Carboxylic acids are more nonpolar

Correct answer: Carboxylic acids form stable dimers via two hydrogen bonds

Carboxylic acids dimerize through two intermolecular hydrogen bonds between the carbonyl oxygen and O–H groups, effectively doubling the interaction energy and raising boiling points.

Question 198: A scientist conducting research on hearing aids fitted 30 mice with the newest technology after they were genetically changed to lose their hearing and were tested to press a lever when they heard a bell. This was set to a range of power levels. Twenty mice pressed the lever at 80% power. 15 mice pressed the lever at 70 percent power. Ten mice pressed the lever with 60 percent power. Which of the following is the absolute threshold for hearing the decibels produced by the bell?

• 80%
• Not enough information given.
• 60%
• 70% (Correct answer)

Correct answer: 70%

Answer Explanation: (B) <br> This question rests exclusively on the knowledge of what defines the absolute threshold of sensation, which is when 50% of the time, the stimulus is recorded. In this question, with the information given, that would mean the power setting that would allow 15 mice to observe the sound of the bell. Below this would be subliminal.

Question 199: Which of the following best describes the concept of 'stigma' as it relates to mental illness, according to sociological perspectives?

• The legal status of individuals with psychiatric diagnoses
• The patient's subjective experience of mental illness
• The neurobiological cause of psychiatric symptoms
• A mark of disgrace that sets a person apart and leads to social discrimination (Correct answer)

Correct answer: A mark of disgrace that sets a person apart and leads to social discrimination

Goffman defined stigma as a deeply discrediting attribute that reduces a person from a 'whole' person to a 'tainted' or 'discounted' one, resulting in social exclusion and discrimination.

Question 200: One day, while doing treatments in his clinic, a dentist is summoned to the front desk to resolve a conflict between one of his patients and the receptionist. The patient is a middle-aged businessman who is upset and making a disturbance because he was told he would have to visit a dental hygienist rather than a dentist. The patient screams angrily that he earns far too much money to be treated by an inexperienced colleague. The clerk informs the dentist that the patient was 40 minutes late for his appointment and that the hygienist was now the only available appointment time.The patient retaliates by saying that his time is more valuable than everyone else's. What type of personality problem do you think this patient has?

• Paranoid
• Obsessive-compulsive
• Histrionic
• Narcissistic (Correct answer)

Correct answer: Narcissistic

The patient's behavior—demanding special treatment, expressing grandiosity about his income, believing his time is more valuable, and reacting with anger when his perceived status is challenged—are classic indicators of Narcissistic Personality Disorder. This disorder is characterized by a pervasive pattern of grandiosity, a need for admiration, and a lack of empathy.

Question 201: What products may C. sporogenes make with 6 molecules of glucose, based on this graph? <br> Clostridium sporogenes is an obligate anaerobe that relies on the glycolytic route for energy. The following figure depicts the path:

• 7 Pyruvate, 7 ATP, 7 NADH, 7H+, 7 H2O
• 12 Pyruvate, 12 ATP, 12 NADH, 12H+, 12 H2O (Correct answer)
• 2 Pyruvate, 2 ATP, 2 NADH, 2H+, 2 H2O
• 6 Pyruvate, 6 ATP, 6 NADH, 6H+, 6 H2O

Correct answer: 12 Pyruvate, 12 ATP, 12 NADH, 12H+, 12 H2O

Glycolysis is the metabolic pathway that breaks down one molecule of glucose into two molecules of pyruvate. For each molecule of glucose, glycolysis produces a net of 2 ATP, 2 NADH, 2 H+, and 2 H2O. Therefore, with 6 molecules of glucose, the process will yield 6 * 2 = 12 molecules of pyruvate, 12 ATP, 12 NADH, 12 H+, and 12 H2O.

Question 202: An affected male with an X-linked recessive disorder has children with an unaffected, non-carrier female. What proportion of his daughters will be carriers?

• 0% — daughters cannot inherit the X-linked allele from the father
• 25% — only one quarter of all children are carrier daughters
• 100% — all daughters will be carriers (Correct answer)
• 50% — half of all daughters will be carriers

Correct answer: 100% — all daughters will be carriers

An affected male (X^a Y) passes his X^a chromosome to every daughter; since the mother provides only normal X alleles, all daughters will be obligate carriers (X^a X^N).

Question 203: The Bohr effect describes which phenomenon in hemoglobin physiology?

• Increased O₂ affinity upon 2,3-BPG binding
• Decreased O₂ affinity at low pH (Correct answer)
• Increased O₂ affinity at high CO₂ concentrations
• Sigmoidal oxygen-binding curve due to cooperativity

Correct answer: Decreased O₂ affinity at low pH

The Bohr effect states that increased H⁺ (lower pH) and CO₂ decrease hemoglobin's oxygen affinity, promoting O₂ release in metabolically active tissues.

Question 204: A CARS passage states: 'The Renaissance was not a sudden awakening but a gradual accumulation of classical rediscoveries.' The author's view most directly challenges which assumption?

• That humanism was the defining ideology of Renaissance thinkers
• That classical texts had no influence on medieval scholars
• That the Renaissance represented a sharp, discontinuous break from the medieval period (Correct answer)
• That Italian city-states were the primary patrons of Renaissance art

Correct answer: That the Renaissance represented a sharp, discontinuous break from the medieval period

By framing the Renaissance as gradual accumulation, the author disputes the conventional picture of it as a sudden, transformative rupture with the past.

Question 205: What would be the most crucial thing for a person to do after using a sauna, according to the article?

• Replenish fluids with filtered water. (Correct answer)
• Shower in cold water.
• Exercise.
• Eat a meal.

Correct answer: Replenish fluids with filtered water.

Saunas induce significant sweating, which leads to a substantial loss of bodily fluids. The most crucial action after using a sauna is to replenish these lost fluids to prevent dehydration and maintain proper bodily function. Drinking filtered water effectively rehydrates the body and restores electrolyte balance.

Question 206: Which factor is most important when evaluating the quality of scientific research for MCAT?

• Number of references cited
• Length of the study report
• Reputation of the authors
• Methodology, sample size, and peer review status (Correct answer)

Correct answer: Methodology, sample size, and peer review status

Research quality is best evaluated by examining the methodology, adequacy of sample size, and whether the study has undergone peer review.

Question 207: A wrestler seeking to lose weight for a December competition sets a goal of losing 30 pounds in two months. Which of the following is NOT an effective way to limit his caloric intake?

• Reward himself with a savory meal every Saturday for meeting his calorie goals.
• Snap himself with a rubber band when he eats a high calorie snack.
• Hide snack food out of sight within his house. (Correct answer)
• Study at a health smoothie store instead of a coffee shop.

Correct answer: Hide snack food out of sight within his house.

The question asks which method is *NOT* an effective way to limit caloric intake. While hiding snack food might reduce impulsive eating by removing visual cues, it doesn't eliminate the food from the environment or address underlying cravings. If the individual knows the food is still present and accessible, they can still retrieve and consume it, making it a less effective long-term strategy for truly limiting overall caloric intake compared to other behavioral interventions.

Question 208: The dentate (pectinate) line in the anal canal marks a transition between which two types of epithelium?

• Stratified squamous to transitional
• Simple columnar to stratified squamous (Correct answer)
• Pseudostratified columnar to simple columnar
• Simple squamous to stratified squamous

Correct answer: Simple columnar to stratified squamous

Above the dentate line the mucosa is simple columnar epithelium; below it transitions to non-keratinized stratified squamous epithelium.

Question 209: The lac repressor protein is inactivated (prevented from binding the operator) when it binds to:

• The operator DNA sequence directly
• RNA polymerase sigma factor
• Cyclic AMP (cAMP)
• Allolactose (a metabolite of lactose) (Correct answer)

Correct answer: Allolactose (a metabolite of lactose)

Allolactose, produced from lactose by beta-galactosidase, acts as the true inducer by binding to the lac repressor and causing a conformational change that prevents operator binding.

Question 210: A passage argues that narrative medicine—training physicians to analyze literary texts—improves patient care. Which of the following would most weaken this argument?

• Literary scholars have long argued that reading fiction builds empathy
• Medical schools with narrative medicine curricula report higher student satisfaction
• Some physicians find narrative medicine courses interesting and personally enriching
• A controlled study shows no measurable difference in patient outcomes between physicians trained in narrative medicine and those who were not (Correct answer)

Correct answer: A controlled study shows no measurable difference in patient outcomes between physicians trained in narrative medicine and those who were not

A controlled study showing no difference in patient outcomes directly undermines the core claim that narrative medicine improves patient care.

Question 211: A HISTORY PASSAGE <br> In the late 18th century, citizens throughout rural Massachusetts shut down courthouses attempting to conduct debt collection hearings, farmers in western Pennsylvania and other parts of the western frontier refused to pay an excise on whiskey, and members of the Pennsylvania Dutch community in the east of the state harassed officials attempting to assess a direct tax on houses. In each case, the government's initial response to protests of "taxation without representation" led to an exacerbation of tensions: radicalized citizens banded together, creating armed militias in open rebellion against the ruling regime. <be> These popular uprisings against taxation and economic hardship were not—as many Americans would now assume upon hearing such descriptions—revolts against the British monarchy in prelude to the American Revolution (1775–83). Rather, Shays' Rebellion (1786–87), the Whiskey Rebellion (1791–94), and Fries's Rebellion (1798–1800) occurred after the British had been vanquished. Though each episode has distinctive historical significance, it is particularly instructive to examine the evolving reaction to popular protest by the incipient United States government. <br> In the case of the uprisings throughout western and central Massachusetts that would come collectively to be known as "Shays' Rebellion," the federal government existed in a much attenuated form, enfeebled due to the considerable amount of sovereignty ceded to the thirteen original states under the Articles of Confederation. After subsistence farmers, veterans of the Continental Army, and other rural citizens found themselves hard-pressed in 1786 by debts incurred during hard times and taxes newly levied by the Massachusetts government, they began to revolt, at first just closing down courts but soon organizing armed militias, culminating in an attempt led by veteran Daniel Shays to seize a federal armory in Springfield. The federal government lacked the funds to assemble its own militia and counter the uprising, so it was left to the governor of Massachusetts, James Bowdoin, to handle—and he had to turn to assistance from more than a hundred wealthy merchants to bankroll mercenaries, who quashed the rebels. <br> The moneyed and propertied interests—creditors to whom many debts were owed—had been unnerved by the events in Massachusetts, and were instrumental in the creation and ratification of the new Constitution, which greatly concentrated power in a more robust central government. When many western farmers refused to pay a 1791 excise tax on whiskey, the newly empowered federal government was able to muster a formidable response after resistance grew more organized. In 1794, President Washington himself led a massive federalized militia of nearly 13,000 troops that would effortlessly scatter the resistance forces. The reaction by President Adams to the smaller rebellion led by John Fries years later would be similarly heavy-handed. <br> This tendency toward increased centralization of power has only worsened since the 18th century. As the federal government has accumulated strength, state and municipal governments—and, ultimately, the people—have lost their sovereignty. And while the moneyed had to foot the bill directly to protect their property (and continue collecting their rents) in quelling Shays' Rebellion, since the adoption of the new Constitution in 1789, the federal government has been able to make the people pay directly for their own repression—a fact recently highlighted in the assault, covertly orchestrated across several cities by the Federal Bureau of Investigation and Department of Homeland Security, on the 2011 Occupy movement. In the end, the people have only traded one master for another: the feudal relic of British monarchy has been usurped by a modern bureaucratic behemoth, ultimately in thrall to the nouveau aristocracy of corporate "persons" and the rapacious class of executives that constitute the homunculi within. <br> "The federal government has been able to make the people directly pay for their own repression," the author states in paragraph 5. Based on the rest of the paragraph, this is most likely meant to convey the following:

• the government requires citizens to pay taxes, which are partly used to fund police and military responses to protests. (Correct answer)
• protesting ultimately incurs worse consequences for individuals today than it did in the 18th century.
• imprisoned protestors are sent a bill for the expenses accrued while they are behind bars.
• popular uprisings no longer occur in the United States due to more successful control of citizens.

Correct answer: the government requires citizens to pay taxes, which are partly used to fund police and military responses to protests.

The passage contrasts the quelling of Shays' Rebellion, where 'the moneyed had to foot the bill directly,' with the post-Constitution era. It states that 'since the adoption of the new Constitution in 1789, the federal government has been able to make the people pay directly for their own repression.' This implies that citizens, through their taxes, fund the government's police and military forces, which are then used to suppress popular protests, effectively making the people finance their own control.

Question 212: Sergey Levin, Levin's half-brother, is working with a philosophy professor on the real-world boundary between psychology and physiology. Which of the following statements would support the professor's point of view?

• Coma patients show a lack of response to any outside influence.
• An animal with the sensory pathways removed from their spinal cord ceases to display any interaction with the environment. (Correct answer)
• Blind individuals have visions of the real world that they could not have derived from memories.
• Scientists discover a brain area that generates consciousness.

Correct answer: An animal with the sensory pathways removed from their spinal cord ceases to display any interaction with the environment.

The professor's argument hinges on the idea that 'perception is based on sensation.' If an animal with its sensory pathways removed (a physiological intervention) ceases to interact with its environment (a psychological/behavioral outcome), it directly supports the professor's view that physiological sensations are fundamental for psychological phenomena like perception and interaction. This demonstrates a clear link between the physical and the mental as he describes.

Question 213: What is the most important professional competency for MCAT certification in sociology?

• Deep knowledge combined with practical application skills (Correct answer)
• Speed of task completion
• Ability to work alone exclusively
• Memorization of all reference materials

Correct answer: Deep knowledge combined with practical application skills

Professional competency requires both deep knowledge of the subject matter and the ability to apply that knowledge in practical situations.

Question 214: A physician notices that patients from collectivist cultures tend to describe illness in terms of family and community impact rather than personal symptoms. This reflects which concept?

• Ethnocentrism
• Cultural competence
• Acculturation
• Individualism versus collectivism (Correct answer)

Correct answer: Individualism versus collectivism

Individualism-collectivism is a cultural dimension describing the extent to which people define themselves through personal versus group identity, influencing health perceptions and communication.

Question 215: In a passage on medical ethics, the author distinguishes between 'therapeutic privilege'—withholding information from patients 'for their own good'—and patient autonomy. The author likely uses this distinction to argue that:

• Physicians should always disclose full medical information regardless of consequences
• Therapeutic privilege is a paternalistic practice that compromises informed consent (Correct answer)
• Patient autonomy is a philosophical ideal impractical in clinical settings
• Medical ethics has evolved to favor physician judgment over patient preferences

Correct answer: Therapeutic privilege is a paternalistic practice that compromises informed consent

Framing therapeutic privilege as withholding information while contrasting it with autonomy signals the author views the practice as paternalistic and ethically problematic.

Question 216: New York City has a population of nearly 7 million people from all walks of life. Although the city has its own distinct qualities, there are various smaller districts, mainly clusters of people of the same nationality who follow the customs of their previous home country. For example, greeting individuals with cheek kisses is still usual in Little Italy, a small village within the city. What kind of phenomenon is this an example of?

• Culture lag
• Subculture (Correct answer)
• Counterculture
• Microculture

Correct answer: Subculture

Answer Explanation: (B) <br> The definitions of these terms are very close together, which make their distinctions important to know to answer questions. In order for customs to be considered counterculture, they must go against norms of the larger area within which they are encapsulated. For a custom to be considered a microculture, it must not be long enough to exist throughout a lifetime. Culture lag can commonly be mixed with retained customs, but it is important to know that lag refers to practices that are outdated by the newer form. Cheek kisses do not go against any of New York’s traditions, so it would just fall under subculture.

Question 217: A researcher crosses true-breeding red flowers with true-breeding white flowers and obtains all pink flowers in F1. This result is best explained by:

• Codominance
• Complete dominance of red over white
• X-linkage
• Incomplete dominance (Correct answer)

Correct answer: Incomplete dominance

Incomplete dominance produces a blended intermediate phenotype (pink) in heterozygotes because neither allele is fully dominant over the other.

Question 218: David is a senior in high school who aspires to be an engineer. He scores a F on his first test in calculus II sophomore year. Which of the following reactions to this experience would indicate that David is more likely to improve in future exams?

• He says the teacher graded his exam harder because she doesn’t like him.
• He decides that the first test is always harder than the others.
• He says it was due to some home circumstances that won’t be present during the next exam.
• He critiques his study methods and tries to find out which led to poor returns. (Correct answer)

Correct answer: He critiques his study methods and tries to find out which led to poor returns.

Answer Explanation: <br> This question focuses on the differences between internal and external locus of control. People with internal locus of control blame outcomes on their personal efforts and abilities, while those with an external locus of control contributes outcomes to fate or forces beyond their control. People with an internal locus of control tend to have more success following failures.

Question 219: Why does the text declare the Bill of Rights to be "ambiguous?"

• The idea of an individual is not well defined.
• Applying these rights to territories of the U.S. is very uncertain.
• There are definitions lacking that create controversy. (Correct answer)
• The rights can be supplanted in times of national emergency.

Correct answer: There are definitions lacking that create controversy.

The text states, 'the ambiguous wording of many of its provisions—such as the Second Amendment’s right 'to keep and bear arms' and the Eighth Amendment’s prohibition of 'cruel and unusual punishments'—has been a source of constitutional controversy and intense political debate.' This clearly indicates that the lack of precise definitions for key terms within these amendments leads to ongoing disputes and makes their application uncertain, hence the ambiguity.

Question 220: In a CARS passage, the author uses the phrase 'to be sure' before presenting a counterargument. This phrase most commonly signals:

• The author's confident assertion of the main thesis
• The author's endorsement of the opposing view
• A factual claim the author considers beyond dispute
• A concession the author grants before returning to defend the main argument (Correct answer)

Correct answer: A concession the author grants before returning to defend the main argument

'To be sure' typically introduces a concession—an acknowledgment that the opposing view has some merit—before the author reasserts or qualifies the main argument.

Question 221: A person who has experienced a traumatic car accident now feels intense anxiety whenever they hear screeching brakes, even in safe contexts. From a behavioral perspective, this anxiety represents:

• Observational learning from watching others' accidents
• A classically conditioned fear response (CR) to a conditioned stimulus (CS) (Correct answer)
• An operantly conditioned avoidance response
• A generalization of instrumental behavior

Correct answer: A classically conditioned fear response (CR) to a conditioned stimulus (CS)

The screeching brakes (CS) were paired with the trauma (UCS), producing a conditioned fear response (CR) through classical conditioning.

Question 222: The Henderson-Hasselbalch equation is used to calculate:

• The solubility product of a sparingly soluble salt
• The concentration of a strong acid solution
• The standard reduction potential of a half-reaction
• The pH of a buffer solution given pKa and the ratio of conjugate base to acid (Correct answer)

Correct answer: The pH of a buffer solution given pKa and the ratio of conjugate base to acid

Henderson-Hasselbalch states pH = pKa + log([A⁻]/[HA]), relating buffer pH to the pKa of the weak acid and the ratio of its conjugate base to acid.

Question 223: A group of engineers working on signal lights for planes that may be used to guide them to runways is trying to figure out how bright the light needs to be for the pilot to notice the tower from a mile away. They adjust the brightness of the light to a test level and establish contact with an oncoming pilot. The pilot claims he can't see the light while he's a mile away from the tower. What would this be called in terms of Signal Detection Theory?

• False alarm
• Correct rejection
• Miss (Correct answer)
• Hit

Correct answer: Miss

Answer Explanation: (A) <br> Signal Detection Theory deals with the expectation of a signal and the corresponding reality that it is accurately perceived. Hit and miss describe reactions by the observer when the stimulus is present. False alarm (false positive) and correct rejection describe reactions by the observer when the stimulus is absent.

Question 224: What may be the next probable passage in the book after this?

• The author discussing characteristics of things that are truthful. (Correct answer)
• A parable on evolution.
• A background in Sphinx and Oedipal mythology.
• A biographical summary of the current philosophers of the time.

Correct answer: The author discussing characteristics of things that are truthful.

The author concludes the passage by stating, 'And to speak in all seriousness, I see such new philosophers beginning to appear.' These new philosophers are described as those who will 'concern himself with such dangerous 'Perhapses'!' and question the 'VALUE of this Will [to Truth],' including whether good and evil are 'essentially identical.' Therefore, the next probable passage would logically delve into these new philosophical perspectives, likely by discussing the nature and characteristics of truth, or its perceived opposites, from this fresh viewpoint.

Question 225: A pharmaceutical company disproportionately conducts clinical trials in wealthy nations and then markets drugs to low-income countries without local testing. This illustrates:

• Publication bias in scientific literature
• Conflict of interest in research design
• Global health inequality reinforced by differential access to research resources (Correct answer)
• Ethical violations under the Declaration of Helsinki

Correct answer: Global health inequality reinforced by differential access to research resources

This practice reflects how global structures of inequality shape which populations benefit from medical research and which are treated as secondary markets.

Question 226: A person who attributes their failure on an exam to being 'bad at tests' (a stable, internal, global cause) is demonstrating which explanatory style?

• Pessimistic explanatory style (Correct answer)
• Self-serving bias
• Fundamental attribution error
• Optimistic explanatory style

Correct answer: Pessimistic explanatory style

Pessimistic explanatory style involves attributing negative events to stable, internal, and global causes, which is associated with learned helplessness and depression.

Question 227: According to some researchers, the US federal government did less to safeguard residents whose homes were taken away in false foreclosures during the 2007–2008 financial crisis than to defend the banks that engaged in this illegal action. What effect does this have on the passage if it's true?

• It challenges the author's central argument.
• It strengthens the claim that the wealthy shaped the creation of the US Constitution.
• It supports the author's central argument. (Correct answer)
• It weakens the assertion that the people have exchanged one master for another.

Correct answer: It supports the author's central argument.

The author's central argument, especially in the final paragraph, is that the federal government has become a 'bureaucratic behemoth, ultimately in thrall to the nouveau aristocracy of corporate 'persons' and the rapacious class of executives.' The hypothetical scenario, where the government protects banks over citizens in foreclosures, directly supports this claim that the government prioritizes powerful corporate interests over the well-being of the general populace, thus strengthening the author's main thesis.

Question 228: A passage argues that modern art has lost its ability to challenge society because it is now commercially driven. The author's primary concern is that:

• Modern artists lack technical training compared to classical painters
• Commercial pressures have undermined art's critical social function (Correct answer)
• Art museums are no longer accessible to the public
• Government arts funding has decreased significantly

Correct answer: Commercial pressures have undermined art's critical social function

The author's central worry is that commercial motives have displaced art's traditional role as a vehicle for social critique.

Question 229: In CARS, the primary purpose of re-reading the last sentence of a passage paragraph is typically to:

• Confirm the paragraph's main point and how it connects to the overall argument (Correct answer)
• Identify the transitional phrase that connects to the next paragraph
• Memorize specific data points for later retrieval
• Locate the topic sentence if it was missed on the first read

Correct answer: Confirm the paragraph's main point and how it connects to the overall argument

Concluding sentences often synthesize the paragraph's argument and signal its relationship to the passage's broader thesis, making them valuable for comprehension.

Question 230: In the second paragraph, the author makes which of the following assumptions?

• The response to Fries's Rebellion was more heavy-handed than the response to Shays' Rebellion.
• The British played a covert role in the rebellions that took place after their defeat in the American Revolution.
• C)The British monarchy is entirely unlike the US federal government that eventually replaced it.
• A significant number of Americans today are unfamiliar with the rebellions that occurred after the Revolution. (Correct answer)

Correct answer: A significant number of Americans today are unfamiliar with the rebellions that occurred after the Revolution.

The second paragraph states, 'These popular uprisings... were not—as many Americans would now assume upon hearing such descriptions—revolts against the British monarchy.' The phrase 'as many Americans would now assume' directly indicates the author's belief that a significant portion of the contemporary American population is unaware of these specific post-Revolutionary rebellions, leading them to misinterpret the initial descriptions.

Question 231: Which reading strategy is most effective when a CARS passage contains an unfamiliar technical term central to the argument?

• Look for a parenthetical definition earlier in the passage before attempting to infer meaning
• Assume the term has the same meaning as its everyday English usage
• Infer the term's meaning from surrounding context and the passage's overall argument (Correct answer)
• Skip the sentence containing the term and return to it after finishing the passage

Correct answer: Infer the term's meaning from surrounding context and the passage's overall argument

Context-based inference is the most reliable strategy on the MCAT CARS section because the answer to vocabulary-in-context questions is always grounded in how the author uses the term.

Question 232: Pregnancy tests are highly sensitive and work by detecting B-hCG, or human chorionic gonadotropin, levels in urine. What tissue secretes this hormone, and what is its function?

• Blastocyst, increase in blood flow
• Blastocyst, corpus luteum maintenance (Correct answer)
• Endometrium, cell division
• Corpus luteum, self-maintenance

Correct answer: Blastocyst, corpus luteum maintenance

Beta-hCG (human chorionic gonadotropin) is secreted by the trophoblast cells of the developing blastocyst shortly after implantation. Its primary function is to maintain the corpus luteum in the ovary, preventing its degeneration. The corpus luteum then continues to produce progesterone, which is essential for maintaining the uterine lining and supporting the early pregnancy.